Total S. japonica RNA extraction and first-strand cDNA synthesis followed Lu (2020) [55 (link)]. cDNA was stored at − 20 °C for subsequent analysis. Gene-specific primers used for qRT-PCR are listed in Table 5. qRT-PCR was performed on a Takara Thermal Cycle Dice™ Real-Time System (Takara, Japan). Conditions used for qRT-PCR were as follows: 94 °C for 2 min 30 s; 40 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 25 s; and one cycle of 95 °C for 15 s, 60 °C for 60 s, and 72 °C for 15 s. Three biological replicates were performed. Reaction mixtures, internal control, and relative transcriptional levels calculation method referred the protocols of Lu et al. (2020) [55 (link)]. SPSS 26.0 was used for statistical analysis.

Primers used for qRT-PCR

GeneForward primer (5′-3′)Reverse primer (5′-3′)
β-actinGACGGGTAAGGAAGAACGGGGGACAACCAAAACAAGGGCAGGAT
SjGST4CTCGTACTTCCCGTTCCTCGCCAGCCCTCACGAAGTAGTC
SjGST20ATAGAGGACATCGCCAGCAAGCTTCACCTTGGGGTGTTCCAT
SjGST22GAATTTGGCGCTCTCAAGCCGTCGTCGGAAGGGTACAGTC
Free full text: Click here