Quantifying Sulfide Quinone Reductase Expression

RNA was isolated from homogenates of freshly isolated rat PAs, mesenteric arteries, aorta, brain, and cultured PASMCs. Reverse transcription of the RNA was carried out as previously described (16 (link)). RT-PCR primer pairs for rat sulfide quinone reductase-like (SQRDL) were designed using Primer3web version 4.0 (http://primer3.ut.ee) and synthesized by Sigma-Aldrich (St. Louis, MO). SQRDL (Accession No. BC158559) primers were sense CTGCAGGACTTCAAGGAAGG and antisense CTCTCCCGAATGATCTCCTG. PCR was carried out using PuReTaq Ready-To-Go PCR Beads (GE Healthcare, Piscataway, NJ), and the PCR products (reaction equivalent on 20 ng reverse transcribed RNA) were analyzed by electrophoresis on 2.8% agarose gels run in TAE buffer (National Diagnostics, Hessle, UK) with PhiX174 DNA/HinfI Marker (Thermoscientific, Waltham, MA).