Cloning and Expression of β-galactosidase Gene

The β-galactosidase BAD_1582 (bgaC) gene sequence of B. adolescentis ATCC15703 was used to design cloning primers for PCR (CACCATGGCAGATACAGCCGAACTC and GAACAGCTTGAGCTGAACGTTGAG). With fosmid clone 31 as template, Velocity DNA polymerase (Bioline) was used to generate a blunt end product (25 cycles: 30 s at 98 °C, 30 s at 63 °C, 1 min and 30 s at 72 °C). PCR products were isolated by DNA gel purification using Promega Wizard R SV gel and PCR clean-up system following the manufacturer’s instructions. The purified blunt end DNA was cloned into expression plasmid pET101 (Invitrogen) following the directional cloning kit protocol. pET101 harbouring the bgaC gene was transformed into the expression host E. coli T7 express lacZ⁻ cells (Qin et al. 2010 (link)); the resulting clone was named E. coli T7express (pDMg1a). The primers ACGTATGCCTCGAATCG and CATATTTGGATAGCTC were used to determine the presence of bgaC in fosmids by PCR using Taq DNA polymerase (Bioline), followed by visualisation of the PCR products by agarose gel electrophoresis.