Six DEGs were validated through a real-time qPCR analysis (Table S5). Three DEGs were randomly chosen, in addition to the most downregulated high-affinity nitrate transporter (NTR2:6) and one NADH-nitrate reductase, which are related to nitrate uptake, and a silicon efflux transporter (LSI3) related to the deposition of silicon in spore valves. Two genotyped strains of C. socialis, namely APC12 and MCA6 were used for this purpose: the former strain is the one used for the transcriptome experiment, while MCA6 is a freshly established strain isolated at station LTER-MC in the Gulf of Naples and for which the D1–D3 region of the nuclear-encoded large subunit ribosomal DNA (partial 28S rDNA) has been sequenced as in [70 ] to confirm its identity.
Triplicate cultures of both strains were maintained in control and low N media, with the same nutrient concentrations used for the RNA-seq experiment. Cells were harvested on day 2 in the control, when the percentage of spores was zero, and on day 3 in the treatments, when the percentage of spores was ~ 33 and ~ 38% for APC12 and MCA6, respectively, corresponding to the ones recorded at T3 of the transcriptome experiment. RNA extraction and purification were performed as illustrated above. Total RNA was reverse-transcribed using the QuantiTect® Reverse Transcription Kit (Qiagen, Venlo, Limburgo, Nederlands).
RTqPCR amplification was performed with cDNA diluted 1:10, in a 10 µl reaction containing each primer at a final concentration of 1 µM and Fast SYBR Green Master mix with ROX (Applied Biosystems) using a ViiA™ 7 Real-Time PCR System (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) and the following cycling parameters: 95 °C for 20 s, 40 cycles at 95 °C for 1 s, 60 °C for 20 s, 95 °C for 15 s, 60 °C 1 min, and a gradient from 60 °C to 95 °C for 15 min. Raw results were processed using the ViiA™ 7 Software and exported into Microsoft Excel for further analyses. The reference gene used was the tubulin gamma chain (TUB G) designed using sequence information from the transcriptome and the software Primer3Plus v.2.4.2 ([71 (link)]). The sequences for the forward and reverse primers are 5’- TGCAGAGTTTGGTCGATGAG -3’and 5’-GGAAGCCAAAGAGTCTGCTG-3’, respectively, yielding a PCR product of 197 bp (TableS5 ). Primers for all other tested DEGs were designed using the same approach. log2(FC)s were obtained with the Relative Expression Software Tool-Multiple Condition Solver (REST-MCS) ([72 (link)]). A pairwise fixed reallocation randomisation test has been used to identify statistically significant results (P ≤ 0.05).
Triplicate cultures of both strains were maintained in control and low N media, with the same nutrient concentrations used for the RNA-seq experiment. Cells were harvested on day 2 in the control, when the percentage of spores was zero, and on day 3 in the treatments, when the percentage of spores was ~ 33 and ~ 38% for APC12 and MCA6, respectively, corresponding to the ones recorded at T3 of the transcriptome experiment. RNA extraction and purification were performed as illustrated above. Total RNA was reverse-transcribed using the QuantiTect® Reverse Transcription Kit (Qiagen, Venlo, Limburgo, Nederlands).
RTqPCR amplification was performed with cDNA diluted 1:10, in a 10 µl reaction containing each primer at a final concentration of 1 µM and Fast SYBR Green Master mix with ROX (Applied Biosystems) using a ViiA™ 7 Real-Time PCR System (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) and the following cycling parameters: 95 °C for 20 s, 40 cycles at 95 °C for 1 s, 60 °C for 20 s, 95 °C for 15 s, 60 °C 1 min, and a gradient from 60 °C to 95 °C for 15 min. Raw results were processed using the ViiA™ 7 Software and exported into Microsoft Excel for further analyses. The reference gene used was the tubulin gamma chain (TUB G) designed using sequence information from the transcriptome and the software Primer3Plus v.2.4.2 ([71 (link)]). The sequences for the forward and reverse primers are 5’- TGCAGAGTTTGGTCGATGAG -3’and 5’-GGAAGCCAAAGAGTCTGCTG-3’, respectively, yielding a PCR product of 197 bp (Table
Free full text: Click here
