Quantifying C. pecorum in Ocular and Urogenital Samples

DNA was extracted from the ocular and urogenital swabs using a QIAmp DNA mini kit as per manufacturer’s instructions (Qiagen). Extracted DNA was then screened for C. pecorum chlamydial presence and load using quantitative real-time PCR (qPCR). The forward primer: 5’ AGTCGAACGGAATAATGGCT 3’, and the reverse primer: 5’ CCAACAAGCTGATATCCCAC 3’ were used for targeting a 204bp fragment of the C. pecorum 16S rRNA gene. All procedures were as previously described by Marsh et al. (2011) [20 (link)] except for the PCR mixture containing 1 x Quantitect SYBR Green PCR mastermix (Qiagen) and 10 μM primers (Sigma) made up to a final volume of 15 μl with PCR-grade water and an initial denaturation of 15 minutes at 94°C. All reactions were performed in duplicate and samples of ≥ 50 copies/μL were considered positive. All reactions were carried out on a Rotor-Gene Q 5-plex HRM platform (Qiagen).