Regulation of Bitter Taste Receptor T2R4

HEK293T cells were obtained from ATCC and maintained in 10% fetal bovine serum at 37°C in a 95% air and 5% CO₂ chamber. hASMCs were a kind gift from Dr Andrew Halayko, Dept. of Physiology, University of Manitoba [20 (link)]. Quinine hydrochloride, yohimbine, denatonium benzoate, dapsone, parthenolide and dextromethorphan hydrobromide (DXM) were purchased from Sigma Aldrich (ON, Canada). Brefeldin A (BFA) was purchased from Cell Signaling Technology (ON, Canada), Mouse monoclonal M2 anti-FLAG antibody was from Sigma Aldrich and rabbit polyclonal anti-T2R4 antibody was from ThermoFisher Scientific (Toronto, ON, Canada). Goat anti-mouse Alexa Fluor-488 and goat anti-rabbit Alexa Fluor-488 were purchased from Molecular Devices (CA, USA). APC conjugated anti-FLAG monoclonal antibody was from BioLegend (CA, USA). The synthetic oligonucleotide primer sequences for human TAS2R4 (F -TCCTGCTGAAGCGGAATATC; R–GAAAAGGTGATGCCTGGCTA) were purchased from Invitrogen.