Generation and Modification of BioID Constructs

Generation of BioID constructs have described previously [20 (link)]. CD63 was amplified from RFP-CD63 pQCXP CMV/TO vector (for CD63 BirA*) or from pCT-CD63-GFP (for BirA*CD63). For CD63 BirA*, Nhe and EcoRI restriction fragments were ligated into pcDNA3.1-MCS BioID by overnight incubation with T4 DNA ligase. In the case of BirA*CD63, EcoRI and HindIII restriction enzymes were used for the digestion, and the fragments were inserted into pcDNA3.1-myc-BioID as above. The ligations were transformed into DH5α and plated on ampicillin-resistant LB-agar plates, incubated overnight at 37 °C for isolation of transformed colonies. Point mutations were made on CD63 sequences in the cases of both CD63 BirA* and BirA*CD63 on the guide DNA sequences using the GENEART mutagenesis kit (Invitrogen; A13282). The primers used were as follows: BirA_CD63-H to M_1F: 5’GCCTGTGCAGTGGGATTGATCGCCATGGGTGTCGGGGCAC3’ and BirA_CD63-H to M_1R: 5’GTGCCCCGACACCCATGGCGATCAATCCCACTGCACAGGC3’. This mutation facilitated the re-introduction of CD63 constructs under the CD63 CRISPR background successfully. The other constructs used in this study, GFP-LMP1, LMP1 BirA*, and BirA* LMP1, were also described previously [20 (link)].