pSG5-BMLF1, pSG5-BMRF1, and pSG5-Rta have been described previously (58 (link)) and were obtained from Shannon Kenney (University of Wisconsin—Madison, USA); pCMV5.1/FLAG-BALF5, pCDNA-HA2-BALF2, pCDNA-HA2-BBLF2/3, pCDNA-HA2-BBLF4, and pCDNA-HA2-BSLF1 were obtained from Ya-Fang Chiu (Chang-Gung University, Taoyuan, Taiwan). pCDNA3-HA(2x)-BVLF1 and pCDNA3-HA-BcRF1 were obtained from Eric Johannsen (University of Wisconsin—Madison, USA) and have been previously described (27 (link)). Plasmids p509, encoding pCMV-BZLF1 (Zta), and p526, encoding oriLyt, have been described previously (59 (link)). p3803, a retroviral vector encoding eGFP-H2B, was described previously (13 (link)). p3622 is a version of p3803 encoding mCherry-H2B. The wild-type EBV plasmid p2089 has been described previously (60 (link)). pCDNA-HA3-BGLF4 was cloned by PCR amplifying BGLF4 from p2089 using primers 5′-CGCGGGTACCGCCACCATGTATCCATATGACGTTCCAGATTACGCTGATGTGAATATGGCTGCGGAG -3′ (forward) and 5′-CGCGGAATTCTCATCCACGTCGGCCATCTGGACC -3′ (reverse) and cloning it into pCDNA3-HA-SUMO1 plasmid (Addgene plasmid no. 21154) at EcoRI/Acc65I sites.
Free full text: Click here
