Extraction of total RNA was from tissues or cells via TRIzol reagents (Invitrogen, Waltham, MA, USA). Detection of the concentration and purity of RNA was via nano-droplet spectrophotometer. With the instructions, reverse transcription of 1 μg total RNA was via the PrimeScript RT kit (Promega, Madison, WI, USA) and synthesis of its complementary DNA (cDNA) was conducted. performance of RT-qPCR was via SYBR Premix Ex TaqTM kit (Takara, Otsu, Japan). The loading control of HIPK1 was glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and that of miR-30 c-5p was U6. The primers were synthesized by RiboBio (Guangzhou, China) [34 (link)].
GenesForward (5ʹ-3ʹ)Reverse (5ʹ-3ʹ)
HIPK1TCCCCATACTACGAGAAGGGTATGTCCCCACCCCTAGTACC
GAPDHCATTCAAGACCGGACAGAGGACATACTGCACACCAGCATCACC
MiR-30 c-5pGCGCGTGTAAACATCCTACACTAGTGCAGGGTCCGAGGTATT
U6GAAGCGCGGCCACGAGAGTGCAGGGTCCGAGGTATT
Free full text: Click here