Knockdown and Knockout Experiments for Fzd4 in Xenopus

For knockdown experiments, antisense HNF1β-MO (CCTCGCTGTGAACAAAA CACAAA; 25 ng/embryo for WMISH/qPCR and 55 ng/embryo for explants), control-MO (CCTCTTACCTCAGTTACAATTTATA; same amounts as for HNF1β-MO), Fzd4/Fzd4s-MO (Gorny et al., 2013 (link); ATTATTCTTCTTCTGTTGCCG CTGA; 5 ng/embryo for WMISH/qPCR and 45 ng/embryo for explants) and Fzd4-mismatch-MO (ATTATTaTTaTTCTaTTGCaGCTaA; same amounts as for Fzd4/Fzd4s-MO). For knockout experiments using CRISPR/Cas, 3 ng/embryo capped sense RNA of Cas9 (Blitz et al., 2013 (link)), prepared by Acc651 linearisation and transcribed with the mMessage mMachine T7 kit (Ambion), was injected animally at the one-cell stage alone or together with 300 pg/embryo uncapped sense Fzd4-gRNA, linearised with DraI and transcribed with a MEGAscript T7 kit (Invitrogen). Fzd4-gRNA was generated by cloning the oligonucleotides 5′phosp-TAGGCACATGGTGATCCTGATG and 5′phosp-AAACCATCAGGATCACCATGTG into pDR274 (Addgene). For target- and predicted potential off-target (CRISPR/Cas Target online predictor; CCTop; Stemmer et al., 2015 (link)) mutation analysis, genomic DNA from 50 explants, per condition and biological replicate, was isolated by using a ‘DNeasy Blood and Tissue Kit’ (Qiagen). The region around the target site and predicted off-target sites was amplified and cloned into the pGem^®-T Easy vector (Promega) for sequence analysis.