Example 2

In this example, guide RNAs were designed to target exon 3 after the ATG initiation codon of C9orf72 (Table 2). The strategy was to introduce small indels that will lead to early termination codon, thus inducing non-sense mediated decay of C9orf72 transcripts to reduce RNA foci and dipeptide formation. FIG. 6A shows the human C9orf72 gene sequence of exon 3 with the locations of the non-sense mediated decay (NMD) guide RNA 1r and 2f and the location and sequence of PCR indel analysis primers C9NMD Indel F1 and R1 marked. FIG. 6B shows the results of agarose gel electrophoresis of the PCR products amplified by the C9NMD-Indel F1 and R1 PCR primers. In this example, HEK293T cells were transfected with LV-SpCas9 (Control) or LV-NMDgR-SpCas9 plasmid (2 μg) in triplicate. FIG. 6C shows the results of digital droplet PCT (ddPCR) analysis of the C9orf72 RNA levels from FIG. 6B.

TABLE 2
Guide RNAs generated for
“Non-sense mediated decay.”
SEQ
ID
guide RNAguide RNA sequenceNO:
NMD gRNA 1rUCGAAAUGCAGAGAGUGGUG5
NMD gRNA 2fAAUGGGGAUCGCAGCACAUA6

Free full text: Click here