Example 7

In the context of gene therapy, inducible gene expression systems may enable gene expression to be triggered at specific times and in specific cell types. To develop a Tet-on system for inducing Klotho gene expression, the ZFP3_VPR construct was cloned into a doxycycline-inducible vector. The ZFP3_VPR and ZFP52_VPR sequences and the inducible vector (Lenti-iCas9-neo, Addgene #85400) were amplified using Clontech HiFi according to the manufacturers protocol and the following primers:

Forward primer for ZFP3_VPR:
(SEQ ID NO. 90)
GACGATGACGATAAGGCCCAGGCGGCCCTGGAGCCC
Reverse primer for both ZFP3_VPR and ZFP52_VPR:
(SEQ ID NO. 91)
GCTGAAGTTGGTGGCATGGTGATGGTGATGATGACCGGTAC
Forward primer for ZFP52_VPR:
(SEQ ID NO. 92)
GACGATGACGATAAGGCCCAAGCTGCCTTAGAACCCGGCG
Forward primer for inducible vector:
(SEQ ID NO. 93)
GCCACCAACTTCAGCCTGCTGAAG
Reverse primer for inducible vector:
(SEQ ID NO. 94)
CTTATCGTCATCGTCTTTGTAATCCATGG
Referring to FIG. 8, expression of Klotho by HK-22 cells transfected with the inducible ZFP3_VPR construct was increased following treatment with doxycycline.

Free full text: Click here