Methylation-Sensitive High-Resolution Melting

The MS-HRM was performed in triplicates with the bisulfite-treated DNA isolated from DBS or WB from each individual. It was performed in a MicroAmp Fast Optical 96-Well Reaction Plate using the 7,500 Fast Real-Time PCR System Mix (Applied Biosystems) with the primers 5′‐GGATTTTTGTATTGCGGTAAATAAG‐3′ and 5′‐CAACTAACCTTACCCACTCCATC‐3′ (forward and reverse, respectively) as previously described^{16 (link)}. The melting temperatures of 78 °C and 83 °C were chosen as a near-proportional amplification of unmethylated and methylated alleles, respectively. As described by Ferreira et al. (2019), the pair of primers used in this study act as a positive control for the bisulfite conversion, process due to the particularity of annealing in the treated DNA (Additional file 2: Figure S1).