Generation of ATP5G1 Mutant NPCs using CRISPR/Cas9

ATP5G1^L32P NPCs were generated using the dCas9 base editor, ABEmax (gift from David Liu, Addgene #112095), as previously described (Koblan et al., 2018 (link)). Briefly, a synthetic sgRNA (TCCTCTAGTCTATTCAGGAA) was selected by manual inspection of the AGS Atp5g1 sequence for a PAM (NGG) site near the desired edit on the (-) strand of the gene. AGS NPCs were nucleofected (Amaxa 4D, program DS113) in P3 solution (Lonza, Alpharetta, GA, USA) containing pCMV ABEmax (500 ng/200,000 cells). Following a 48 hr recovery period, the same cells were nucleofected with the synthetic sgRNA sequence above (100 pmol, Synthego, Menlo Park, CA, USA). Cells were expanded and then clonally plated. Clones were screened by PCR as the desired base edit also introduced a new BfaI restriction enzyme cutting site. Sanger sequencing was used to confirm the two WT and three KI clone sequences utilized. Potential off-target effects of CRISPR/Cas9 cleavage were analyzed by Sanger sequencing of the top 5 predicted off-target genomic locations [https://mit.crispr.edu], which demonstrated a lack of indels for all clones used in subsequent analysis.