Fungal DNA Isolation and Sequencing

The samples were crushed in liquid nitrogen and DNA extraction was carried out using the Norgen Biotek Plant/Fungi DNA isolation kit (Norgen Biotek Corp, Cat. 26200) according to the manufacturer’s instructions. Three biological replicates were used for each sample and three technical replicates were included as shown in Figure 1C. The DNA samples were sent to Novogene Co., Ltd. (Singapore) for amplification of the ITS regions (ITS1) and sequencing. PCR reactions were conducted using Phusion ® High-fidelity PCR Master Mix (New England Biolabs), with the primers ITS5-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC; White et al., 1990 ). PCR amplification was performed using the following conditions: 95°C for 120 s; 32 cycles of 94°C for 30s, 55°C for 30s, 72°C for 45 s; and 72°C for 10 min (Bellemain et al., 2010 (link)). The negative control consisted of nuclease-free water instead of the sample DNA. PCR products were checked on 2% agarose gel and quantity and purity was assessed by Nanodrop and Qubit 2.0. Products between 400–450 bp were mixed at equal density ratios and purified using the Qiagen Gel Extraction Kit (Qiagen, Germany). Sequencing was performed using the Illumina NovaSeq PE250. The libraries were generated with NEBNext® UltraTM DNA Library Prep Kit for Illumina (New England Biolabs, Cat. E7370L).