C. elegans samples (approximately 10,000 animals per sample) were collected by washing using M9 buffer with 0.01% Tween20. To remove residual OP50 E. coli culture, the worm pellet was applied onto M9 buffer with 10% sucrose solution and spun in a clinical centrifuge at full speed for 1 min. The resulting pellet was transferred into a pre-chilled (with liquid N2) mortar and ground with mortar and pestle. The resulting sample grind was stored at -80°C. Total RNA was extracted from the frozen grind of the worms sample using TRIzol extraction (Life Technology, 15596–026). The resulting sample was treated with DNase I (NEB M0303L) and followed by phenol:chloroform (1,1) purification. The resulting total RNA was re-suspended with dH2O and stored at -80°C. First strand cDNA synthesis was done using SuperScript III RT kit (Life Technology, 18080–044) and using 1ug of the total RNA and oligo(dT)20 for mRNA enrichment. The resulting cDNA samples were used for qPCR. All qPCR reactions were done in triplicate, using KAPA SYBR FAST kit (KAPA Biosystems). Each mRNA level was quantified with reference to the mRNA level of tba-1 [98 (link)]. The primers used for pck-2 were: CGATATCACCACATGGCTTG and GCTTTCCCAGTCTGGATGAA; for F47B8.10: GCTTCACAAGCTGGGTTCTC and CGAAGACGTACACGGAATGA.
Free full text: Click here
