Quantification of mRNA Expression Levels

mRNA expression levels were analyzed following a previously described protocol [23 (link)]. Briefly, total RNAs were extracted from the stimulated prostate cancer cell lines using TRIzol reagent (Takara Biotechnology Co., Dalian, China). Subsequently, the extracted RNA was converted into cDNA using the PrimeScript RT reagent kit (Takara, Dalian, China). The expression levels of the target genes were quantified using the SYBR Premix Ex Taq kit (Takara, Dalian, China) and the Bio-Rad CFX-96 thermal cycler(Bio-Rad, Hercules, CA). Normalization of the target gene mRNA expression levels was achieved by co-amplification of β-actin. Primers sequences used for real-time PCR were: HMOX1 (forward:5ʹ—gctatgtgaagcggctccac—3ʹ; reverse: 5ʹ—cagggctttctgggcaatc—3ʹ);β-actin (forward: 5ʹ—gcacagagcctcgcctt—3ʹ; reverse:5ʹ—gttgtcgacgacgagcg-3ʹ).