Antisense Morpholinos for Zebrafish Gene Knockdown

Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC (Philomath, OR, USA). MOs were solubilized in DNase/RNase-free water to generate 4 mM stock solutions, which were stored at 20 °C. Zebrafish embryos were injected at the 1-cell stage with 5 nL of diluted MO. Optimal dosage was determined by previously published doses and our own experience [53 (link)]. esr1 was targeted with 5′–catgtaaaacaggctggtcacCTTG–3′ (0.4 mM). Esr2a was targeted with 5′–agagagtcttacCTTGTATACTC–3′ (0.8 mM). Esr2b was targeted with 5′–ttgaccatgagcattacCTTGAATG–3′ (0.8 mM) [53 (link)]. Uab127 embryos were genotyped with the forward primer 5′–GTCCCGCTTAGTCCCACAAT–3′ and the reverse primer 5′–TGACAGCTGCCACCTAAAGA–3′ [54 (link)].