ChIP-qPCR Assay for PAX3 Binding

Following the manufacturer’s instructions, the ChIP assay was performed by the EZ-CHIP™ chromatin immunoprecipitation kit (Merck Millipore). Briefly, BGSCs and differentiated glioma cells were lysed, and anti-PAX3 polyclonal antibodies (sc-34918, Santa Cruz Biotechnology) was used in the chromatin immunoprecipitation. In ChIP-qPCR assay, primers of the p53 promoter were as follows (5′-3′): ATGTTAGTATCTACGGCACCAG (forward) and CAGCCCGAACGCAAAGTG (reverse). By ABI 7500 with SYBR Green detection (Applied Biosystems), qRT-PCR was carried out according to the standard protocol. To account for chromatin sample preparation differences (ΔCp_{Normalized ChIP}), input DNA (non-IP enriched) values were used to normalize each ChIP DNA fraction’s Cp (crossing point) value inputting DNA fraction Cp value. Based on the normalized IgG only IP fraction Cp value ΔΔCp = (ΔCp_{Normalized ChIP} − (ΔCp_{Normalized IgG})), the normalized ChIP fraction Cp values were adjusted. Above the sample specific background, the ChIP assay site fold enrichment was then calculated as 2^(−ΔΔCp) (Brooks et al., 2016 (link)).