Primer extension inhibition assays were performed as described
12 (link). Briefly, 1 nM cap0 or VPg-linked RNA were incubated with 1.5 μM Ifit proteins for 10 minutes at 37°C in reactions containing 20 mM Tris pH 7.5, 100 mM KCl, 2.5 mM MgCl
2, 1 mM ATP, 0.2 mM GTP, 1 mM DTT and 0.25 mM spermidine. RT was carried out using 2.5 U avian myeloblastosis virus (AMV) reverse transcriptase (Promega) and a
32P-labelled primer in the presence of 4 mM MgCl
2 and 0.5 mM dNTPs. Primer sequences used for RT were CCTGCTCAGGAGGGGTCATG (MNV-1), GTCATAACTGGCACAAGAAGG (FCV) and GTCGTGGGGTGCCAGAAATC (PSaV). Sequencing reactions were performed using the Sequenase Version 2.0 DNA Sequencing Kit (ThermoFisher) in the presence of
35S-labelled ATP. cDNA products were resolved on 6% denaturing PAGE and detected by autoradiography using an FLA7000 Typhoon Scanner (GE).
12 (link). Briefly, 1 nM cap0 or VPg-linked RNA were incubated with 1.5 μM Ifit proteins for 10 minutes at 37°C in reactions containing 20 mM Tris pH 7.5, 100 mM KCl, 2.5 mM MgCl
2, 1 mM ATP, 0.2 mM GTP, 1 mM DTT and 0.25 mM spermidine. RT was carried out using 2.5 U avian myeloblastosis virus (AMV) reverse transcriptase (Promega) and a
32P-labelled primer in the presence of 4 mM MgCl
2 and 0.5 mM dNTPs. Primer sequences used for RT were CCTGCTCAGGAGGGGTCATG (MNV-1), GTCATAACTGGCACAAGAAGG (FCV) and GTCGTGGGGTGCCAGAAATC (PSaV). Sequencing reactions were performed using the Sequenase Version 2.0 DNA Sequencing Kit (ThermoFisher) in the presence of
35S-labelled ATP. cDNA products were resolved on 6% denaturing PAGE and detected by autoradiography using an FLA7000 Typhoon Scanner (GE).
Free full text: Click here
