RhoGDI, Ubc9, and PIAS Double Knockdown Protocol

Cells were subjected to a double knock-down protocol using Lipofectamine RNAiMAX (Life Technologies) to deliver 10 nM of RhoGDIα (#1: s698 - CCAGCAUACGUACAGGAAA, #2: s699 - GUCUAACCAUGAUGCCUUA, #3: s700 - CCAUGAUGCCUUAACAUGU, Ambion Silencer Select, Life Technologies), RhoGDIβ (#1: s455 - GGAAGGUUCUGAAUAUAGA, #2: s456 - CCAUGGACCUUACUGGAGA, #3: s224014 - GUGGAUAAAGCAACAUUUA, Ambion Silencer Select, Life Technologies), Ubc9 (stealth predesigned UBE2IHSS111130 - UCGAACCACCAUUAUUUCACCCGAA, Life Technologies) or 100 nM PIAS1-4 (PIAS1 – GGAUCAUUCUAGAGCUUUA, PIAS2 – CUUGAAUAUUACAUCUUUA, PIAS3 – CCCUGAUGUCACCAUGAAA, PIAS4 – GGAGUAAGAGUGGACUGAA) [23] (link) siRNA oligos. As a control, 100 nM of Luciferase (CGUACGCGGAAUACUUCGA, Sigma) siRNA oligo was used. Cells were transfected 48 and 24 hours before harvest.

Free full text: Click here

Schou J., Kelstrup C.D., Hayward D.G., Olsen J.V, & Nilsson J. (2014). Comprehensive Identification of SUMO2/3 Targets and Their Dynamics during Mitosis. PLoS ONE, 9(6), e100692.

Publication 2014

Lipofectamine RNAiMAX Ambion Silencer Select

Cells Lipofectamine Luciferase Oligo Oligos Pias1 Pias3 Sirna

Corresponding Organization :

Other organizations : Novo Nordisk Foundation, University of Copenhagen

Top 5 similar protocols

Variable analysis

independent variables

RhoGDIα knockdown (s698, s699, s700)
RhoGDIβ knockdown (s455, s456, s224014)
Ubc9 knockdown (UBE2IHSS111130)
PIAS1-4 knockdown (PIAS1, PIAS2, PIAS3, PIAS4)

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: Luciferase (CGUACGCGGAAUACUUCGA) siRNA oligo

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!