Extraction and Analysis of D. dadantii RNAs

RNAs from D. dadantii were extracted as previously described (61 (link)) from cultures grown to the early exponential phase (OD₆₀₀ of 0.2) and to the early stationary phase (OD₆₀₀ of 1.2 for cells grown in M63-sucrose, OD₆₀₀ of 1.5 in M63-sucrose-plant extract medium, and OD₆₀₀ of 1.9 for cells grown in M63-sucrose-PGA medium or M63-sucrose-PGA-plant extract medium). The different OD₆₀₀s retained for the various culture media correspond to a similar growth stage (i.e., the transition from the late exponential phase to the early stationary phase). Complementation with PGA, plant extract, or both PGA and plant extract does not modify the bacterial growth rate, but it does increase the final biomass. Isolated RNA was quantified spectrophotometrically using an ND 2000 Nanodrop spectrophotometer, visualized on an agarose gel for quality, and stored at −80°C until further use. The absence of genomic DNA contamination was checked by PCR. Four target genes were selected to assess the impact of novobiocin and the stresses in quantitative reverse transcription (RT-qPCR) experiments as previously described in reference 61 (link) (see Fig. S8 in the supplemental material). The primers used for these RT-PCR experiments are as follows: 16S RNA, forward, GATCATGGCTCAGATTGAACG, and reverse, AGTTATCCCCCTCCATCAGG; gyrB, forward, AGTATTAAAAGGGCTGGATGC, and reverse, ACCGACACCGAGTTATCAGC; pelE, forward, AGCGAATTCAAAGCAGCACT, and reverse GGCGTTTCGATGTACAGGTT; and asr, forward, GCTCTGGGTCTGTCCTCTGT, and reverse, CTGAGCTTTCTGCGTTGC.