PCR and Sanger Sequencing of PKD Genes

Primers for PKD1 and PKD2 target genes were designed using the Premier 6.0 software. The primer sequences were as follows: PKD1-F2: GTGGTGGAGATGGACGTAGAGT; PKD1-R2: CGGAAATAGGGCAGGATTAGCG; PKD1-F3: ACACA GTGGAGCATGTGTACC; PKD1-R3: GACCTTGATGTCCGTGAC CA; PKD1-F4: CGAGTCACCATCACGGATGGT; PKD1-R4: ACCCAGGCAGGCACTATGAGA; PKD2-F3: AATGGTGGTGGAGATGG ACGTA; PKD2-R3: CCCCAGATGTACTCTTTCACTCTAA; GANAB-F1: GAATGTATGAAGGATGACCCAA; GANAB-R: CGCAGGTGAATACTCCAATC. The reaction conditions and PCR system were as follows: 1.5 μl of DNA template (200 ng/μl), 1 μl of each upstream and downstream primer (10 μmol/l), 2 μl of dNTP mix, 1 μl of PrimeSTAR GXL DNA polymerase (TAKARA), 10 μl of 5× PrimeSTAR GXL buffer Mg²⁺, 4 μl of dNTP mixture, and up to 50 μl of nucleic acid-free water; amplification of the PCR reaction: 3 min predenaturation at 95°C, 30 s denaturation at 94°C, 15 s annealing temperature, 30 s extension at 72°C, 35 cycles, 5 min extension at 72°C, and storage at 4°C. After electrophoresis on a 1% agarose gel at 110 V for 30 min and staining, PCR products were detected with a gel imager. Sequencing reactions were prepared using a BigDye^® Terminator kit (Applied Biosystems), and reaction products were sequenced using the ABI 3500Dx Genetic Analyzer (Applied Biosystems, Forster City, USA). Sanger sequencing was performed by Tsingke Biotechnology Co., Ltd.