Isolation and Characterization of Muribaculaceae Strain

Fresh fecal samples from DSS group were collected and mixed in anaerobic sterile Ringer working buffer in an anaerobic workstation (Don Whitley Scientific Ltd, Shipley, UK). The 10⁵ diluted suspension with Ringer working buffer was placed onto 46 medium plates (Table S1) and incubated under anaerobic condition (80% N₂, 10% CO₂, and 10% H₂) at 37°C for 7 days. The 16S rRNA gene of each colony was obtained using the primers 27-F (AGAGTTTGATCCTGGCTCAG) and 1492-R (GGTTACCTTGTTACGACTT). The obtained 16S rRNA sequences were sequenced and aligned with the ASVs in Muribaculaceae enriched in the gut of DSS-treated mice. One Muribaculaceae strain (MF13079) was isolated using a previously reported MPYG medium [41 (link)] which was modified by adding 3% fetal bovine serum (FBS, GIBCO, 10099-141). The Muribaculaceae strain MF13079 16S rRNA sequence was aligned with the GenBank. All the 16S rRNA sequence of the isolated strains in the family Muribaculaceae and the 16S rRNA sequence of the representative strains in other families of the phylum Bacteroidota were selected to build a phylogenetic tree by using the Neighbor-Joining method in MEGA 6.