Amplification of T. cruzi kDNA Hypervariable Region

A 330 bp sequence belonging to the hypervariable region of T. cruzi kDNA was amplified as reported (Schijman et al., 2011 (link)). Briefly, the master mix was composed by 1X Taq platinum amplification buffer, 200 µM dNTPs, 3 mM MgCl₂ solution, 1.5 U Taq platinum (Invitrogen, Brazil), 10 µM kDNA specific primers 121 (AAATAATGTACGGGKGAGATGCATGA) and 122 (GGTTCGATTGGGGTTGGTGTAATATA), 5 µl of template DNA, and a quantity of water sufficient to give a final volume of 50 µl. Cycling parameters were one step of 3 min denaturation at 94°C; 2 cycles of 1 min at 97.5°C, 2 min at 64°C; 33 cycles of 1 min at 94°C, 1 min at 62°C and one final extension step of 10 min at 72°C. The kDNA-PCR products were analyzed in 2% agarose gels stained with ethidium bromide.