Maternal Zld Depletion in Drosophila

Orego-R was used as wild-type (wt) strain. gd⁷/gd⁷ and gd⁷/Y flies were obtained from gd⁷/winscy, P{hs-hid}5 parents, which were heat-shocked during the second to third instar larval stage at 37°C for 1 h for 2 d. zld⁻ embryos were depleted of maternal Zld through the “Maternal-Gal4-shRNA” system (Staller et al. 2013 (link)), where MTD-Gal4/UAS-shRNA-zld females were crossed to wt males. The MTD-Gal4 stock (Petrella et al. 2007 (link)), which drives robust Gal4 expression throughout oogenesis, as well as the passenger strand sequence CGGATGCAAGTTGCAGTGCAA targeting zld transcripts (shRNA-zld) were obtained from the Perrimon laboratory. The UAS-shRNA-zld vector was then constructed using the Valium22 vector and injected as previously described (Ni et al. 2011 (link)). Maternal zld⁻ embryonic phenotypes, as described in Liang et al. (2008) (link) using a zld null allele in germ line clones, were confirmed by embryonic lethality, in situ hybridization of Zld target genes, and immunofluorescent staining with antibodies against Zld (Nien et al. 2011 (link); data not shown).