Engineered Glufosinate Resistance Gene

The Streptomyces hygroscopicus bar gene conferring resistance to glufosinate (Avalos et al. 1989 (link)) was amplified by polymerase chain reaction (PCR) from pBAR-GEM 7.2 (Pall and Brunelli 1993 ) using primers Bar-BstB1-F (5′ TTCGAAGTCGACAGAAGATGATATTG 3′) and Bar-BstB1-R (5′ TTCGAAGAACCGGCAGGCTGAAGTCC 3′). The resulting 912-bp DNA fragment was ligated into pCR blunt (Invitrogen, Carlsbad, CA) generating plasmid pJV1. The 1690-bp DNA fragment containing the tcu-1 promoter was generated by PCR on wild-type (WT) genomic DNA using primers P_tcu-1 F-NotI (5′ TTTGCGGCCGCGATGGGATAGAGAGAATGGC 3′) and P_tcu-1 R ApaI (5′ TTTGGGCCCGGTTGGGGATGTGTGTGC 3′). The PCR product was cut with NotI and ApaI, and ligated into pJV1 digested with the same enzymes, creating pCR blunt bar::P_tcu-1 (plasmid and sequence deposited at the Fungal Genetic Stock Center).