Characterization of Oxidative Stress Response in E. coli

The strains, plasmids, and primers used in this work are listed in Table 1. Plasmid pOxyRS-sfGFP-AAV is derived from pOxyRS-sfGFP^{38 (link)} and incorporates a ssrA degradation tag encoding AANDENYLAAAV^{45 (link)} (“AAV”) at the 3ʹ end of sfGFP.Table 1

Strains, plasmids, and primers used in this study.

	Description	Source
Strains
E. coli
NEB10-beta	Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14-ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (Str^R) rph spoT1 Δ(mrr-hsdRMS-mcrBC)	New England Biolabs
W3110	K12 strain, wild type, λ-, F-, IN(rrnD-rrnE)1, rph-1s	Genetic Stock Center Yale University, New Haven, CT
ZK126	W3110 ΔlacU169 tna-2	^{58 (link)}
SW102	ZK126 ΔoxyRS	^{59 (link)}
Plasmids
pOxyRS-sfGFP	pBR322, oxyR under constitutive proD promoter, sfGFP under oxyS promoter. Amp^R	^{38 (link)}
pOxyRS-sfGFP-AAV	pOxyRS-sfGFP derivative with ssrA degradation tag encoding AANDENYLAAAV (“AAV”) at 3ʹ end of sfGFP before stop codon. Amp^R	This work

Primers	Sequence and purpose	Source
oxyR_F	gccagccgacgcttagc (for oxyR qPCR)	^{60 (link)}
oxyR_R	aacatcacgcccagctcatc (for oxyR qPCR)	^{60 (link)}
16S_rRNA_F	gttaatacctttgctcattga (for E. coli 16s rRNA qPCR)	^{61 (link)}
16S_rRNA_R	accagggtatctaatcctgtt (for E. coli 16s rRNA qPCR)	^{61 (link)}
katG_F	gccgatctacaacccgac (for katG qPCR)	This work
katG_R	gtagaagcagatgcccagg (for katG qPCR)	This work

Free full text: Click here

Zakaria F.R., Chen C.Y., Li J., Wang S., Payne G.F, & Bentley W.E. (2024). Redox active plant phenolic, acetosyringone, for electrogenetic signaling. Scientific Reports, 14, 9666.

Publication 2024

mrr-hsdRMS-mcrBC

Corresponding Organization :

Other organizations : University of Maryland, College Park

Top 5 similar protocols

Variable analysis

independent variables

Strains: NEB10-beta, W3110, ZK126, SW102
Plasmids: pOxyRS-sfGFP, pOxyRS-sfGFP-AAV

dependent variables

Expression level of sfGFP (with and without AAV degradation tag)

control variables

Growth conditions (not explicitly mentioned)
Measurement techniques (not explicitly mentioned)

controls

Positive control: pOxyRS-sfGFP plasmid
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!