Quantitative RT-PCR Analysis of CXCL12 and CXCR4 Expression

Total RNA was extracted from T9-T13 DRGs from control and TNBS-injected rats with Trizol (Invitrogen). cDNA was synthesized from total RNA using an Omniscript RT kit 50 (QIAGEN) following the supplier’s instructions. The sequences of the primers for CXCL12, CXCR4, and β-actin (as an internal control) used in quantitative polymerase chain reaction were as follows: CXCL12 forward: CGATTCTTTGAGAGCCATGTC, CXCL12 reverse: TTAAGGCTTTGTCCAGGTACTCT; CXCR4 forward: CTCTGAGGCGTTTGGTGCT, CXCR4 reverse: TGCCCACTATGCCAGTCAAG, β-actin forward: TCAGGTCATCACTATCGGCA, β-actin reverse: GGCATAGAGGTCTTTACGGAT. Control reaction was carried out in the absence of cDNA templates. The Ct value was defined as the cycle number at which fluorescence intensity reached a certain threshold where amplification of each target gene was within the linear region of the reaction amplification curves. The relative expression level for each target gene was normalized by Ct value of β-actin using a 2^ΔΔCt relative quantification method as described previously.^{24 (link)}