Fungal Molecular Identification Protocol

Genomic DNA was extracted from mycelium taken from fungal colonies on MEA
using the UltraClean™ Microbial DNA Isolation Kit (Mo Bio Laboratories,
Inc., Solana Beach, CA, U.S.A.). A part of the nuclear rDNA operon spanning
the 3' end of the 18S rRNA gene (SSU), the first internal transcribed spacer
(ITS1), the 5.8S rRNA gene, the second ITS region (ITS2) and the first 900 bp
at the 5' end of the 28S rRNA gene (LSU) was amplified and sequenced as
described by Cheewangkoon et al.
(2008 ) standard for all
strains included (Table 1). For
selected strains (see Table 1),
the almost complete SSU and LSU (missing the first and last 20–30
nucleotides) were amplified and sequenced using novel and previously published
primers (Table 2; see
below).
Table 2.

Details of primers used for this study and their relation to selected
published primers. Primer names ending with a “d” denotes a
degenerate primer whereas those ending with a “m” denotes specific
primers designed based on the partial novel sequences generated. The start and
end positions of the primers are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3' direction.

Name	Sequence (5′-3′)	Orientation	%GC	Tm (°C)	Start	End	Reference
5.8S1Fd	CTC TTG GTT CBV GCA TCG	Forward	57.4	49.8 - 54.2 - 56.8	2333	2350	This study
5.8S1Rd	WAA TGA CGC TCG RAC AGG CAT G	Reverse	52.3	57.6 - 58.9 - 60.2	2451	2472	This study
F377	AGA TGA AAA GAA CTT TGA AAA GAG AA	Forward	26.9	40.3	3005	3030	www.lutzonilab.net/primers/page244.shtml
ITS1	TCC GTA GGT GAA CCT GCG G	Forward	63.2	49.5	2162	2180	White et al. (1990 )
ITS1F	CTT GGT CAT TTA GAG GAA GTA A	Forward	36.4	39.0	2124	2145	Gardes & Bruns (1993 (link))
ITS1Fd	CGA TTG AAT GGC TCA GTG AGG C	Forward	54.5	48.0	2043	2064	This study
ITS1Rd	GAT ATG CTT AAG TTC AGC GGG	Reverse	47.6	43.1	2671	2691	This study
ITS4	TCC TCC GCT TAT TGA TAT GC	Reverse	45.0	41.6	2685	2704	White et al. (1990 )
ITS4S	CCT CCG CTT ATT GAT ATG CTT AAG	Reverse	41.7	42.9	2680	2703	Kretzer et al. (1996 )
ITS5	GGA AGT AAA AGT CGT AAC AAG G	Forward	40.9	40.8	2138	2159	White et al. (1990 )
LR0R	GTA CCC GCT GAA CTT AAG C	Forward	52.6	43.2	2668	2686	Rehner & Samuels (1994 )
LR2	TTT TCA AAG TTC TTT TC	Reverse	23.5	28.5	3009	3025	www.lutzonilab.net/primers/page244.shtml
LR2R	AAG AAC TTT GAA AAG AG	Forward	29.4	30.4	3012	3028	www.lutzonilab.net/primers/page244.shtml
LR3	GGT CCG TGT TTC AAG AC	Reverse	52.9	40.5	3275	3291	Vilgalys & Hester (1990 (link))
LR3R	GTC TTG AAA CAC GGA CC	Forward	52.9	40.5	3275	3291	www.lutzonilab.net/primers/page244.shtml
LR5	TCC TGA GGG AAA CTT CG	Reverse	52.9	41.0	3579	3595	Vilgalys & Hester (1990 (link))
LR5R	GAA GTT TCC CTC AGG AT	Forward	47.1	37.8	3580	3596	www.biology.duke.edu/fungi/mycolab/primers.htm
LR6	CGC CAG TTC TGC TTA CC	Reverse	58.8	43.5	3756	3772	Vilgalys & Hester (1990 (link))
LR7	TAC TAC CAC CAA GAT CT	Reverse	41.2	35.3	4062	4078	Vilgalys & Hester (1990 (link))
LR8	CAC CTT GGA GAC CTG CT	Reverse	58.8	44.3	4473	4489	www.lutzonilab.net/primers/page244.shtml
LR8R	AGC AGG TCT CCA AGG TG	Forward	58.8	44.3	4473	4489	www.lutzonilab.net/primers/page244.shtml
LR9	AGA GCA CTG GGC AGA AA	Reverse	52.9	43.6	4799	4815	www.lutzonilab.net/primers/page244.shtml
LR10	AGT CAA GCT CAA CAG GG	Reverse	52.9	41.6	5015	5031	www.lutzonilab.net/primers/page244.shtml
LR10R	GAC CCT GTT GAG CTT GA	Forward	52.9	41.6	5013	5029	www.lutzonilab.net/primers/page244.shtml
LR11	GCC AGT TAT CCC TGT GGT AA	Reverse	50.0	43.9	5412	5431	www.lutzonilab.net/primers/page244.shtml
LR12	GAC TTA GAG GCG TTC AG	Reverse	52.9	39.4	5715	5731	Vilgalys & Hester (1990 (link))
LR12R	CTG AAC GCC TCT AAG TCA GAA	Forward	47.6	43.7	5715	5735	www.biology.duke.edu/fungi/mycolab/primers.htm
LR13	CAT CGG AAC AAC AAT GC	Reverse	47.1	38.8	5935	5951	www.lutzonilab.net/primers/page244.shtml
LR14	AGC CAA ACT CCC CAC CTG	Reverse	61.1	47.6	5206	5223	www.lutzonilab.net/primers/page244.shtml
LR15	TAA ATT ACA ACT CGG AC	Reverse	35.3	32.5	2780	2796	www.lutzonilab.net/primers/page244.shtml
LR16	TTC CAC CCA AAC ACT CG	Reverse	52.9	42.1	3311	3327	Moncalvo et al. (1993 )
LR17R	TAA CCT ATT CTC AAA CTT	Forward	27.8	31.2	3664	3681	www.lutzonilab.net/primers/page244.shtml
LR20R	GTG AGA CAG GTT AGT TTT ACC CT	Forward	43.5	43.6	5570	5592	www.lutzonilab.net/primers/page244.shtml
LR21	ACT TCA AGC GTT TCC CTT T	Reverse	42.1	41.7	3054	3072	www.lutzonilab.net/primers/page244.shtml
LR22	CCT CAC GGT ACT TGT TCG CT	Reverse	55.0	46.8	2982	3001	www.lutzonilab.net/primers/page244.shtml
LSU1Fd	GRA TCA GGT AGG RAT ACC CG	Forward	55.0	41.8 - 44.0 - 46.3	2655	2674	This study
LSU1Rd	CTG TTG CCG CTT CAC TCG C	Reverse	63.2	49.6	2736	2754	This study
LSU2Fd	GAA ACA CGG ACC RAG GAG TC	Forward	57.5	45.5 - 46.5 - 47.6	3280	3299	This study
LSU2Rd	ATC CGA RAA CWT CAG GAT CGG TCG	Reverse	52.1	48.3 - 49.0 - 49.8	3379	3402	This study
LSU3Fd	GTT CAT CYA GAC AGC MGG ACG	Forward	57.1	44.7 - 47.4 - 50.2	3843	3863	This study
LSU3Rd	CAC ACT CCT TAG CGG ATT CCG AC	Reverse	56.5	49.1	3876	3898	This study
LSU4Fd	CCG CAG CAG GTC TCC AAG G	Forward	68.4	51.2	4469	4487	This study
LSU4Rd	CGG ATC TRT TTT GCC GAC TTC CC	Reverse	54.3	47.4 - 48.7 - 50.0	4523	4545	This study
LSU5Fd	AGT GGG AGC TTC GGC GC	Forward	70.6	51.6	3357 / 5072	3373 / 5088	This study
LSU5Rd	GGA CTA AAG GAT CGA TAG GCC ACA C	Reverse	52.0	48.3	5355	5379	This study
LSU6Fd	CCG AAG CAG AAT TCG GTA AGC G	Forward	54.5	48.1	5499	5520	This study
LSU6Rd	TCT AAA CCC AGC TCA CGT TCC C	Reverse	54.5	48.6	5543	5564	This study
LSU7Fd	GTT ACG ATC TRC TGA GGG TAA GCC	Forward	52.1	46.0 - 47.4 - 48.8	5943	5966	This study
LSU7Rd	GCA GAT CGT AAC AAC AAG GCT ACT CTA C	Reverse	46.4	47.9	5927	5954	This study
LSU8Fd	CCA GAG GAA ACT CTG GTG GAG GC	Forward	60.9	51.2	3469	3491	This study
LSU8Rd	GTC AGA TTC CCC TTG TCC GTA CC	Reverse	56.5	48.9	4720	4742	This study
LSU9Fm	GGT AGC CAA ATG CCT CGT CAT C	Forward	54.5	47.9	4882	4903	This study
LSU9Rm	GAT TYT GCS AAG CCC GTT CCC	Reverse	59.5	49.2 - 50.0 - 50.9	4979	4999	This study
LSU10Fm	GGG AAC GTG AGC TGG GTT TAG A	Forward	54.5	48.6	5543	5564	This study
LSU10Rm	CGC TTA CCG AAT TCT GCT TCG G	Reverse	54.5	48.1	5499	5520	This study
LSU11Fm	TTTGGTAAGCAGAACTGGCGATGC	Forward	50.0	49.4	3753	3776	This study
LSU12Fd	GTGTGGCCTATCGATCCTTTAGTCC	Forward	52.0	48.3	5355	5379	This study
NS1	GTA GTC ATA TGC TTG TCT C	Forward	42.1	36.9	413	431	White et al. (1990 )
NS1R	GAG ACA AGC ATA TGA CTA C	Reverse	42.1	36.9	413	431	www.lutzonilab.net/primers/page244.shtml
NS2	GGC TGC TGG CAC CAG ACT TGC	Reverse	66.7	53.8	943	963	White et al. (1990 )
NS3	GCAAGTCTGGTGCCAGCAGCC	Forward	66.7	53.8	943	963	White et al. (1990 )
NS4	CTT CCG TCA ATT CCT TTA AG	Reverse	40.0	38.2	1525	1544	White et al. (1990 )
NS5	AAC TTA AAG GAA TTG ACG GAA G	Forward	36.4	40.1	1523	1544	White et al. (1990 )
NS6	GCA TCA CAG ACC TGT TAT TGC CTC	Reverse	50.0	47.5	1806	1829	White et al. (1990 )
NS7	GAG GCA ATA ACA GGT CTG TGA TGC	Forward	50.0	47.5	1806	1829	White et al. (1990 )
NS8	TCC GCA GGT TCA CCT ACG GA	Reverse	60.0	50.4	2162	2181	White et al. (1990 )
NS17	CAT GTC TAA GTT TAA GCA A	Forward	31.6	34.2	447	465	Gargas & Taylor (1992 )
NS18	CTC ATT CCA ATT ACA AGA CC	Reverse	40.0	38.0	887	906	Gargas & Taylor (1992 )
NS19	CCG GAG AAG GAG CCT GAG AAA C	Forward	59.1	49.3	771	792	Gargas & Taylor (1992 )
NS20	CGT CCC TAT TAA TCA TTA CG	Reverse	40.0	37.3	1243	1262	Gargas & Taylor (1992 )
NS21	GAA TAA TAG AAT AGG ACG	Forward	33.3	30.5	1193	1210	Gargas & Taylor (1992 )
NS22	AAT TAA GCA GAC AAA TCA CT	Reverse	30.0	36.4	1687	1706	Gargas & Taylor (1992 )
NS23	GAC TCA ACA CGG GGA AAC TC	Forward	55.0	45.5	1579	1598	Gargas & Taylor (1992 )
NS24	AAA CCT TGT TAC GAC TTT TA	Reverse	30.0	36.2	2143	2162	Gargas & Taylor (1992 )
SR11R	GGA GCC TGA GAA ACG GCT AC	Forward	60.0	47.8	779	798	Spatafora et al. (1995 (link))
SR1R	TAC CTG GTT GAT TCT GC	Forward	47.1	38.5	394	410	Vilgalys & Hester (1990 (link))
SR3	GAA AGT TGA TAG GGC T	Reverse	43.8	34.8	696	711	www.biology.duke.edu/fungi/mycolab/primers.htm
SSU1Fd	CTG CCA GTA GTC ATA TGC TTG TCT C	Forward	48.0	46.5	407	431	This study
SSU1Rd	CTT TGA GAC AAG CAT ATG AC	Reverse	40.0	48.7	416	435	This study
SSU2Fd	GAA CAA YTR GAG GGC AAG	Forward	50.0	47.8 - 50.7 - 53.5	930	947	This study
SSU2Rd	TAT ACG CTW YTG GAG CTG	Reverse	47.2	48.4 - 49.9 - 51.2	974	991	This study
SSU3Fd	ATC AGA TAC CGT YGT AGT C	Forward	44.7	48.4 - 49.5 - 50.5	1389	1407	This study
SSU3Rd	TAY GGT TRA GAC TAC RAC GG	Reverse	47.5	49.0 - 52.5 - 56.0	1397	1416	This study
SSU4Fd	CCG TTC TTA GTT GGT GG	Forward	52.9	50.0	1670	1686	This study
SSU4Rd	CAG ACA AAT CAC TCC ACC	Reverse	50.0	50.3	1682	1699	This study
SSU5Fd	TAC TAC CGA TYG AAT GGC	Forward	47.2	48.9 - 50.1 - 51.2	2037	2054	This study
SSU5Rd	CGG AGA CCT TGT TAC GAC	Reverse	55.6	52.5	2148	2165	This study
SSU6Fm	GCT TGT CTC AAA GAT TAA GCC ATG CAT GTC	Forward	43.3	49.0	423	452	This study
SSU6Rm	GCA GGT TAA GGT CTC GTT CGT TAT CGC	Reverse	51.9	50.1	1707	1733	This study
SSU7Fm	GAG TGT TCA AAG CAG GCC TNT GCT CG	Forward	55.8	51.0 - 52.2 - 53.3	1153	1178	This study
SSU7Rm	CAA TGC TCK ATC CCC AGC ACG AC	Reverse	58.7	49.5 - 50.8 - 52.1	1921	1943	This study
SSU8Fm	GCA CGC GCG CTA CAC TGA C	Forward	68.4	52.2	1848	1866	This study
V9G	TTA CGT CCC TGC CCT TTG TA	Forward	45.0	42.8	2002	2021	de Hoog & Gerrits van den Ende (1998 (link))

Novel primers were designed using a variety of complete SSU and LSU
sequences obtained from the GenBank sequence database
(www.ncbi.nlm.nih.gov/).
The selection was not limited only to fungi belonging to the
Dothideomycetes but encompassed as many as possible full sequences in
order to make the primers as robust as possible. We aimed to keep the melting
temperature (Tm) of the novel primers at 40–45 °C and the GC content
to approximately 50 % to keep them as compatible as possible to existing
published primers. Primer parameters were calculated using the OligoAnalyzer
tool on the web site of Integrated DNA Technologies
(http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/)
with the “Oligo Conc” parameter set at 0.2 mM and the “Na+
Conc” parameter set at 16 mM. A framework of existing and novel primers
was then aligned onto the sequence of Magnaporthe grisea (GenBank
accession AB026819) to derive primer positions
(Table 2) and evaluate coverage
over the gene regions. These primers were amplified and sequenced in the
following overlapping sections to cover the almost complete SSU and LSU for
the selected strains (Table 2):
SSU1Fd or SSU6Fm with SSU2Rd, SSU2Fd with SSU3Rd, SSU7Fm with SSU4Rd or
SSU6Rm, SSU4Fd with 5.8S1Rd, V9G or LSU1Fd with LSU3Rd, LSU8Fd with LSU8Rd,
LSU4Fd with LSU5Rd, and LSU5Fd with LSU7Rd. For some strains
(Table 3) it was necessary to
add an additional overlap for SSU4Fd with 5.8S1Rd (using SSU4Fd with SSU7Rm
and SSU8Fm with 5.8S1Rd), for LSU8Fd with LSU8Rd (using LSU8Fd with LSU3Rd and
LSU3Fd with LSU8Rd), and for LSU5Fd with LSU7Rd (using LSU5Fd with LSU6Rd and
LSU6Fd with LSU7Rd) to complete the gaps due to large insertions.
Table 3.

Isolates containing group I intron sequences. The insertion positions of
these introns are derived using Magnaporthe grisea GenBank accession
AB026819 as reference in the 5'–3' direction.

Isolate	Insertion between	18S or 28S nrDNA	Intron size (bp)	Blast result
Batcheloromyces leucadendriCBS 110892	1559 - 1560	18S nrDNA	350	No significant similarity
	1820 - 1821	18S nrDNA	399	190/252 of AY545722 Hydropisphaera erubescens 18S nrDNA
	4875 - 4876	28S nrDNA	328	211/264 of DQ246237 Teratosphaeria mexicana 28S nrDNA
	5424 - 5425	28S nrDNA	538	No significant similarity
	5538 - 5539	28S nrDNA	383	218/283 of EU181458 Trichophyton soudanense 28S nrDNA
Batcheloromyces proteaeCBS 110696	1559 - 1560	18S nrDNA	325	No significant similarity
	1820 - 1821	18S nrDNA	399	191/254 of AY545722 Hydropisphaera erubescens 18S nrDNA
	4875 - 4876	28S nrDNA	328	211/263 of DQ246237 Teratosphaeria mexicana 28S nrDNA
	5424 - 5425	28S nrDNA	535	75/90 of DQ442697 Arxula adeninivorans 26S nrDNA
	5538 - 5539	28S nrDNA	372	34/36 of GQ120133 Uncultured marine fungus 18S nrDNA
Catenulostroma macowaniiCBS 110756	1559 - 1560	18S nrDNA	395	297/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
	5424 - 5425	28S nrDNA	914	No significant similarity
Catenulostroma macowaniiCBS 111029	1559 - 1560	18S nrDNA	395	303/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
	5424 - 5425	28S nrDNA	914	No significant similarity
Cercospora apiiCBS 118712	1820 - 1821	18S nrDNA	733	288/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora capsici CPC 12307	1820 - 1821	18S nrDNA	732	287/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora janseanaCBS 145.37	1820 - 1821	18S nrDNA	350	295/365 of EU167577 Mycosphaerella milleri 18S nrDNA
Devriesia staurophoraCBS 375.81	3560 - 3561	28S nrDNA	309	No significant similarity
Miuraea persicae CPC 10069	1820 - 1821	18S nrDNA	603	399/443 of DQ848342 Mycosphaerella populorum 18S nrDNA
Mycosphaerella latebrosaCBS 652.85	1559 - 1560	18S nrDNA	370	234/296 of DQ848311 Septoria betulae 18S nrDNA
	1820 - 1821	18S nrDNA	933	Matches same species
	2168 - 2169	18S nrDNA	494	377/449 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	481	No significant similarity
	missing 5018 - 5019	28S nrDNA	Not present	Not present
	5424 - 5425	28S nrDNA	680	No significant similarity
	5538 - 5539	28S nrDNA	471	No significant similarity
Micosphaerella latebrosaCBS 687.94	1559 - 1560	18S nrDNA	370	231/295 of DQ848310 Septoria betulae 18S nrDNA
	1820 - 1821	18S nrDNA	918	Matches same species
	2168 - 2169	18S nrDNA	494	377/449 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	480	No significant similarity
	5018 - 5019	28S nrDNA	417	144/181 of AF430703 Beauveria bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	680	No significant similarity
	5538 - 5539	28S nrDNA	471	No significant similarity
Mycosphaerella marksiiCBS 110942	1559 - 1560	18S nrDNA	341	332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Mycosphaerella marksii CPC 11222	1559 - 1560	18S nrDNA	341	332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora-like genus CPC 11876	5538 - 5539	28S nrDNA	580	No significant similarity
Passalora bellynckiiCBS 150.49	1559 - 1560	18S nrDNA	409	147/191 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora dodonaea CPC 1223	5424 - 5425	28S nrDNA	738	No significant similarity
Phacellium paspaliCBS 113093	4875 - 4876	28S nrDNA	340	161/197 of DQ248314 Symbiotaphrina kochii 28S nrDNA
Phaeophleospora eugeniicola CPC 2557	missing 5424 - 5425	28S nrDNA	Not present	Not present
	5538 - 5539	28S nrDNA	744	No significant similarity
Phaeophleospora eugeniicola CPC 2558	5424 - 5425	28S nrDNA	1846	No significant similarity
	5538 - 5539	28S nrDNA	744	No significant similarity
Pseudocercospora angolensisCBS 112933	5018 - 5019	28S nrDNA	379	No significant similarity
Pseudocercospora angolensisCBS 149.53	5018 - 5019	28S nrDNA	379	No significant similarity
Pseudocercospora punctataCBS 113315	5424 - 5425	28S nrDNA	723	No significant similarity
	5538 - 5539	28S nrDNA	725	67/73 of AF430699 Beauveria bassiana 28S nrDNA
Pseudocercospora punctata CPC 10532	5424 - 5425	28S nrDNA	731	No significant similarity
	5538 - 5539	28S nrDNA	725	67/73 of AF430699 Beauveria bassiana 28S nrDNA
Ramularia coleosporii CPC 11516	1559 - 1560	18S nrDNA	445	No significant similarity
Ramularia grevilleana CPC 656	5538 - 5539	28S nrDNA	546	No significant similarity
Septoria apiicolaCBS 400.54	5424 - 5425	28S nrDNA	763	No significant similarity
Septoria obesaCBS 354.58	1820 - 1821	18S nrDNA	575	No significant similarity
	2168 - 2169	18S nrDNA	548	394/454 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	430	No significant similarity
Septoria pyricolaCBS 222.31	5424 - 5425	28S nrDNA	723	No significant similarity
Septoria quercicolaCBS 663.94	1559 - 1560	18S nrDNA	334	241/308 of DQ848303 Mycosphaerella latebrosa 18S nrDNA
	1820 - 1821	18S nrDNA	442	379/452 of DQ848335 Mycosphaerella latebrosa 18S nrDNA
	4875 - 4876	28S nrDNA	345	No significant similarity
	5018 - 5019	28S nrDNA	367	122/155 of DQ518980 Lipomyces spencermartinsiae 28S nrDNA
	5424 - 5425	28S nrDNA	526	No significant similarity
	5538 - 5539	28S nrDNA	603	No significant similarity
Septoria rosaeCBS 355.58	1820 - 1821	18S nrDNA	496	No significant similarity
Sonderhenia eucalypticola CPC 11252	1559 - 1560	18S nrDNA	408	339/404 of DQ848314 Mycosphaerella populorum 18S nrDNA
	4875 - 4876	28S nrDNA	337	229/289 of AB044641 Cordyceps sp. 28S nrDNA
	5424 - 5425	28S nrDNA	705	No significant similarity
Stigmina plataniCBS 110755	1559 - 1560	18S nrDNA	379	40/44 of AB007686 Exophiala calicioides 18S nrDNA
	5018 - 5019	28S nrDNA	376	No significant similarity
Stigmina synanamorph CPC 11721	5018 - 5019	28S nrDNA	371	No significant similarity
Teratosphaeria aff. nubilosaCBS 114419	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria aff. nubilosaCBS 116283	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria juvenalisCBS 110906	1559 - 1560	18S nrDNA	403	52/61 of DQ471010 Rutstroemia firma 18S nrDNA
	4875 - 4876	28S nrDNA	345	224/290 of EF115309 Cordyceps bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	478	47/50 of EF115313 Cordyceps bassiana 28S nrDNA
	5538 - 5539	28S nrDNA	402	No significant similarity
Teratosphaeria juvenalisCBS 111149	1559 - 1560	18S nrDNA	403	52/61 of DQ471010 Rutstroemia firma 18S nrDNA
	4875 - 4876	28S nrDNA	345	224/290 of EF115309 Cordyceps bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	478	47/50 of EF115313 Cordyceps bassiana 28S nrDNA
	5538 - 5539	28S nrDNA	402	No significant similarity
Teratosphaeria mexicanaCBS 110502	954 - 955	18S nrDNA	316	129/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
	1559 - 1560	18S nrDNA	360	No significant similarity
	1820 - 1821	18S nrDNA	388	128/168 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
	3560 - 3561	28S nrDNA	383	124/151 of EF647754 Thecaphora thlaspeos 28S nrDNA
	4875 - 4876	28S nrDNA	327	99/114 of L81104 Gaeumannomyces graminis var. tritici 28S nrDNA
	5018 - 5019	28S nrDNA	315	No significant similarity
	5424 - 5425	28S nrDNA	553	No significant similarity
Teratosphaeria mexicanaCBS 120744	954 - 955	18S nrDNA	318	130/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
	1559 - 1560	18S nrDNA	360	No significant similarity
	1820 - 1821	18S nrDNA	389	85/109 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
	3560 - 3561	28S nrDNA	378	119/155 of AY298780 Lentinellus castoreus 18S nrDNA
	4875 - 4876	28S nrDNA	327	162/200 of AB033530 Penicillium sabulosum 18S nrDNA
	5018 - 5019	28S nrDNA	309	No significant similarity
	5424 - 5425	28S nrDNA	659	No significant similarity
Teratosphaeria nubilosaCBS 115669	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria aff. nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria nubilosaCBS 116005	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria aff. nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria ohnowaCBS 112896	954 - 955	18S nrDNA	325	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	3560 - 3561	28S nrDNA	294	168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
	5424 - 5425	28S nrDNA	607	47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria ohnowaCBS 112973	954 - 955	18S nrDNA	324	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	3560 - 3561	28S nrDNA	294	168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
	5424 - 5425	28S nrDNA	607	47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria pseudosuberosaCBS 118911	3560 - 3561	28S nrDNA	324	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	4875 - 4876	28S nrDNA	364	No significant similarity
Teratosphaeria sp. CBS 208.94	954 - 955	18S nrDNA	342	No significant similarity
	3560 - 3561	28S nrDNA	309	59/70 of AY207244 Mycena pura 28S nrDNA
	4875 - 4876	28S nrDNA	296	44/51 of EF551317 Tremella globispora 28S nrDNA
Teratosphaeria suberosa CPC 11032	5424 - 5425	28S nrDNA	313	159/197 of AB033529 Penicillium oblatum 18S nrDNA
	5538 - 5539	28S nrDNA	596	80/99 of AB044639 Cordyceps kanzashiana 28S nrDNA
Thedgonia-like genus CPC 12304	1820 - 1821	18S nrDNA	444	262/331 of EU167577 Mycosphaerella milleri 18S nrDNA

The internal transcribed spacer regions, as well as all insertions
(Table 3) were excluded from
all analyses. Sequence data were deposited in GenBank
(Table 1) and alignments in
TreeBASE
(www.treebase.org).
Two separate analyses were performed: The first using only partial LSU data
due to the limited number of complete LSU sequences available and the second
using the almost complete SSU, 5.8S nrDNA and LSU alignment.
Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4
(Stamatakis 2006 (link)) for the
partial LSU alignment. A general time reversible model (GTR) with a discrete
gamma distribution and four rate classes was applied. A tree was obtained by
simultaneously running a fast bootstrap search of 1000 pseudoreplicates
(Stamatakis et al.
2008) followed by a search for the most likely tree. Maximum
Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the
nodes (Fig. 1).
Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4
(Stamatakis 2006 (link)) for the
almost complete SSU, 5.8S nrDNA and LSU alignment. A general time reversible
model (GTR) with a discrete gamma distribution and four rate classes was
applied to each partition (SSU, 5.8S nrDNA and LSU). A tree was obtained by
simultaneously running a fast bootstrap search of 500 pseudoreplicates
(Stamatakis et al.
2008) followed by a search for the most likely tree. Maximum
Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the
nodes (Fig. 2).

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Crous P.W., Schoch C.L., Hyde K.D., Wood A.R., Gueidan C., de Hoog G.S, & Groenewald J.Z. (2009). Phylogenetic lineages in the Capnodiales. Studies in Mycology, 64, 17-47-S7.

Publication 2009

Corresponding Organization :

Other organizations : Westerdijk Fungal Biodiversity Institute, National Center for Biotechnology Information, National Institutes of Health, Mae Fah Luang University, Stellenbosch University

Top 5 similar protocols

Protocol cited in 36 other protocols

Variable analysis

independent variables

Genomic DNA was extracted from mycelium taken from fungal colonies on MEA

dependent variables

A part of the nuclear rDNA operon spanning the 3' end of the 18S rRNA gene (SSU), the first internal transcribed spacer (ITS1), the 5.8S rRNA gene, the second ITS region (ITS2) and the first 900 bp at the 5' end of the 28S rRNA gene (LSU) was amplified and sequenced

control variables

The selection of primers was not limited only to fungi belonging to the Dothideomycetes but encompassed as many as possible full sequences in order to make the primers as robust as possible
Primer parameters were calculated using the OligoAnalyzer tool to keep the melting temperature (Tm) of the novel primers at 40–45 °C and the GC content to approximately 50 % to keep them as compatible as possible to existing published primers

positive controls

No positive controls were explicitly mentioned.

negative controls

No negative controls were explicitly mentioned.

Annotations

This protocol is too long. Unable to provide accurate annotations

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!