Reverse Transcription and PCR for Daphnia Sir2

Total RNA was isolated from D. pulicaria using RNAzol B reagent (TelTest). cDNA was synthesized at using random hexamer primers, 1 μg total RNA, M-MuLV reverse transcriptase, 500 μM dNTPs, and RNase Inhibitor RNasin (Promega) as previously described [12 (link)]. For each PCR reaction, 2 μl of total cDNA and 50 pmoles each of the forward and reverse primers were used with the Promega GoTaq PCR kit. The following conditions were used for PCR: 95⁰ C for 5 minutes (initial denaturation), denaturation at 95⁰ C for 30 seconds, annealing at 56° C for 5′ half Sir2, 58⁰ C for 3′ half Sir2, or 59⁰ C for GAPDH for 30 seconds, extension at 72° C for 60 seconds. We ran 40 cycles for the initial amplification of Daphnia Sir2 5′ and 3′ halves for cloning, and 27 cycles for the analysis of sir2 mRNA knockdown in the RNAi experiment. The linear range was determined by varying cycle numbers and performing a densitometric analysis of the amplified product for the reverse transcriptase PCR in the RNAi experiment. Note the Sir2 PCR product shown in Figure 6B is the 3′ half of Daphnia Sir2 ORF. Primer sequences used were as follows:
5′ half Sir2Forward:
5′CATATGACCATGGCCGACGAACAAGGCGAG3′
Reverse:
5′ATGTTCTGCGTGTAGTTGCG3′
3′ half Sir2Forward:
5′CGACCGTTCTTTAAATTCGC3′
Reverse:
5′TCAATCCATCGCTTTCCTTTTTAC3′
GAPDHForward:
5′TTATCACCTCCTCAACTTC3′
Reverse:
5′CTTCTTCCTTCACTTCTCC3′