1 × 108 cells were harvested at 800g for 10 minutes at 4°C and washed in ice-cold PBS and quick-frozen in dry ice for 1 minute. RNA was purified using an RNeasy minikit (Qiagen) according to the manufacturer’s instructions. The RNA concentration was quantified using an ND-1000 spectrophotometer (Nanodrop Technologies). qRT-PCR was performed using iQ-SYBR green Supermix on a MiniOpticon real-time PCR (RT-PCR) detection system (Bio-Rad), and quantified using OPTICON3 software (Bio-Rad) (52 (link)). The following primers were used: IGP48-RTF (CTGCAGGCTGCCAGCTCTG), IGP48-RTR (TTTAATCTCCCGTACGCAGG), IGP40-RTF (CTGCATGTGACTGCTGCT), IGP40-RTR (TGAAAGGGTATACAACTGACC), IGP34-RTF (ATTGCGTCTACCGATGGAAC), IGP34-RTR (TAGACTCCTCATCTGAATGC). Data were normalised against TERT (telomerase reverse transcriptase) (Brenndörfer et al., 2010) (TERT-RTF (GAGCGTGTGACTTCCGAAGG) and TERT-RTR (AGGAACTGTCACGGAGTTTGC)).
Protocol detail
RNA Extraction and qRT-PCR Analysis
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : University of Dundee, University of Aberdeen
Top 5 similar protocols
Variable analysis
independent variables
- RNA purification protocol (using RNeasy minikit)
- RNA concentration (quantified using ND-1000 spectrophotometer)
- Gene expression levels (measured by qRT-PCR)
- Cell harvesting (1 × 10^8 cells harvested at 800g for 10 minutes at 4°C)
- Cell washing (in ice-cold PBS)
- Cell freezing (quick-frozen in dry ice for 1 minute)
- Housekeeping gene (TERT) used for data normalization
- Positive control: Not explicitly mentioned
- Negative control: Not explicitly mentioned
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!