Gene Expression Analysis of HCMV and PDGFRα

mRNA was reverse transcribed to complementary DNA (cDNA) using the 5X All-In-One Reverse Transcription MasterMix (Applied Biological Materials, Richmond, BC, Canada). The cDNA was analyzed for the relative amount of target genes by qPCR using EvaGreen qPCR master mix (Applied Biological Materials, Richmond, BC, Canada). The relative abundance of HCMV IE1 [67 (link)] and PDGFRα expression at the mRNA level was determined by normalizing against a housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). HCMV IE: sense 5′-TGAGGATAAGCGGGAGATGT-3′ and antisense 5′-ACTGAGGCAAGTTCTGCAGT-3′. PDGFRα: sense 5′- TAGTGCTTGGTCGGGTCTTG -3′ and antisense 5′- TTCATGACAGGTTGGGACCG -3′. GAPDH: sense 5′-TCCTGCACCACCAACTGCTT-3′ and antisense 5′-TCTTACTCCTTGGAGGCCAT-3′.