Quantifying Drosophila Gene Expression

RNA was extracted from 20 whole bodies, 20 bodies without heads, or 60 heads from 5 day old male flies (unless otherwise indicated) of the indicated genotype, using TRIzol (Life Technologies) and Direct-zol RNA MiniPrep extraction kit (Zymo Research). cDNA was generated using the iSCRIPT cDNA Synthesis kit (Bio-Rad). Quantitative real-time PCR (qPCR)-based quantification was performed for the following genes using the indicated primers:
GBA1a
Forward ACGATGACCAACGCTATTCC
Reverse ATACCAGTGCAGCGATAGCC
dGBA1b
Forward GAACCAGAGCAATCCCTTCA
Reverse TCATCGAGAGTCACGTCCAC
CG31413
Forward CAAGTCCCTTGAAGCCAGAG
Reverse CGAAGGACGAGAGGCAATAC
Rap2L
Forward CCGCTGAAGGTAATGCCTTG
Reverse CGTTTATCCGATCCTTTGCAGA
qPCR was performed using iTaq Universal SYBR Green Supermix (Bio Rad) and a LightCycler 480 (Roche) machine. The delta-delta log₂ method was used to calculate fold change in expression levels. Rap2L was used as the internal control, as the expression of this gene has been reported as the most invariant across different genotypes and ages [66 (link)]. Each experiment was performed at least three times.

Free full text: Click here

Davis M.Y., Trinh K., Thomas R.E., Yu S., Germanos A.A., Whitley B.N., Sardi S.P., Montine T.J, & Pallanck L.J. (2016). Glucocerebrosidase Deficiency in Drosophila Results in α-Synuclein-Independent Protein Aggregation and Neurodegeneration. PLoS Genetics, 12(3), e1005944.

Publication 2016

TRIzol Direct-zol RNA MiniPrep extraction kit iSCRIPT cDNA Synthesis kit iTaq Universal SYBR Green Supermix LightCycler 480

Bodies Cdna Expression gene Flies Genes Genotypes Heads Male Primers Quantitative real time pcr Sybr green Synthesis Trizol

Corresponding Organization : University of Washington

Other organizations : Sanofi (United States)

Top 5 similar protocols

Variable analysis

independent variables

Genotype of the flies

dependent variables

Expression levels of GBA1a
Expression levels of dGBA1b
Expression levels of CG31413

control variables

RNA was extracted from 20 whole bodies, 20 bodies without heads, or 60 heads from 5 day old male flies
Rap2L expression was used as the internal control

controls

Rap2L was used as the positive control, as its expression has been reported to be the most invariant across different genotypes and ages

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!