Quantifying NRF2 mRNA Expression

Total RNA was extracted from cells using TRIsure reagent (Bioline, France) and assessed for RNA quality and quantity by 1% (w/v) agarose gel electrophoresis and NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Italy). After removing any potential genomic DNA contamination, cDNA synthesis was performed from 1 μg total RNA using the QuantiTect reverse transcription kit (Qiagen) following manufacturer’s instructions. The transcript levels of nrf2 were quantified by quantitative Polymerase Chain Reaction (qPCR) using the QuantiTect SYBR^®Green PCR Kit (Qiagen) in a Rotor-Gene Q2 plex Hrm thermocycler (Qiagen). cDNA samples (1:50 diluted) were amplified using gene-specific qPCR primers for target gene (nrf2F: TTTCAGCAGCATCCTCTCCA and nrf2R: AGCCTTCAATAGTCCCGTCC) and for reference genes (gadphF: TCCATGACAACTTTGGCATTG; gadphR: TCACGCCACAGCTTTCCA; 36b4F: GGACCCGAGAAGACCTCCTT; and 36b4R: GCACATCACTCAGAATTTCAATGG). Biological replicates (n = 6) were run in duplicate together with minus reverse transcriptase and no template controls for each reaction. PCR efficiency and specificity were evaluated as previously described [27 (link)]. The normalization factor calculated by the GeNorm Software from the two most stable reference genes (gadph and 36b4) was used to correct the raw data as reported by Nagasawa et al. [28 (link)].

Free full text: Click here

Riolo K., Rotondo A., La Torre G.L., Marino Y., Franco G.A., Crupi R., Fusco R., Di Paola R., Oliva S., De Marco G., Savastano D., Cuzzocrea S., Gugliandolo E, & Giannetto A. (2023). Cytoprotective and Antioxidant Effects of Hydrolysates from Black Soldier Fly (Hermetia illucens). Antioxidants, 12(2), 519.

Publication 2023

TRIsure reagent NanoDrop 2000 spectrophotometer QuantiTect reverse transcription kit QuantiTect SYBR®Green PCR Kit Rotor-Gene Q2 plex Hrm thermocycler

Agarose gel electrophoresis Biological Cdna Dna contamination Genes Genomic Nrf2 Primers Reverse transcriptase Reverse transcription Sybr green Synthesis

Corresponding Organization :

Other organizations : University of Messina

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

Transcript levels of nrf2

control variables

Total RNA quality and quantity assessed by 1% (w/v) agarose gel electrophoresis and NanoDrop 2000 spectrophotometer
Potential genomic DNA contamination removed prior to cDNA synthesis
Reference genes (gadph and 36b4) used for normalization of target gene (nrf2) expression

controls

Positive controls: Minus reverse transcriptase controls for each reaction
Negative controls: No template controls for each reaction

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!