Generation of Vert-X Mice for Il10 Study

A 20 kb genomic fragment containing Il10 along with flanking sequences was isolated via recombineering from BAC clone RP23-122P5 (BACPAC Resource Center, Children’s Hospital Oakland). A 6.8 kb EcoRI fragment containing the 5^th exon, the endogenous polyA site and the 3′ UTR of Il10 was subsequently subcloned into pBluescript II KS (Stratagene). A floxed neomycin-IRES-eGFP cassette (15 (link)) was cloned into the HindIII site between the endogenous stop and polyA sites of il10, followed by subcloning of an HSV-TK cassette (16 (link)) into the SalI site of pBluescript II KS. After linearizing with NotI, the targeting vector was electroporated into a C57BL/6 ES cell line, and ES cell clones were selected with G418 and gancyclovir. Correctly targeted clones, screened initially by PCR followed by Southern blot confirmation (17 (link)) were injected into C57BL/6 albino blastocysts implanted into C57BL/6 females. Male chimeric mice were bred to C57BL/6 albino females to screen for germ line transmission. The neomycin cassette was floxed-out using C57BL/6 Zp3-Cre mice (Jackson laboratories, Bar Harbor), and correctly targeted heterozygous mice were interbred to generate homozygous Vert-X (Vert, fr. green; X, roman numeral 10) mice. Genotyping of Vert-X mice was performed by PCR using the following oligonucleotides: (a) il10 5′ ACCAAGGTGTCTACAAGGCCATGAATGAATT; (b) GFP 5′ GAGGAAATTGCATCGCATTGTCTGAGTAGGT; (c) il10 3′ CAAAGGCAGACAAACAATACACCATTCCCA.