Quantifying IL-1β Expression in Eosinophils

Purified PBEos were cultured 1 hour +/− MβCD or MβCD+Chol, then, stimulated with media +/−1 nM IL-5 for 4 hours. Total RNA was extracted (RNeasy Mini Kit [Qiagen; Valencia, CA, USA]), and the reverse transcription reaction was performed using the Superscript III system (Invitrogen/Life Technologies; Grand Island, NY, USA). mRNA expression was determined by qPCR using SYBR Green Master Mix (SABiosciences; Frederick, MD, USA). Human IL-1β specific primers (forward primer: TCGAGGCACAAGGCACAACAGG; reverse primer: CCATGGCTGCTTCAGACACTTGAGC) were used to quantify IL-1β mRNA levels, using the reference gene, β-glucuronidase to normalize. Data are expressed as fold change using the comparative cycle threshold (ΔΔCT) method as described previously [45] (link), and values given are fold change (2-ΔΔCt) compared to the level in media-pretreated, non-stimulated eosinophils, which was set at 1 (n = 5).