ALCL-cell derived cell lines (SR786, Karpas290, SUP-M2, SUDH1L and DEL), CTCL-derived cell lines (MyLa, Mac-1), and PTCL-NOS (T8ML1) derived cell lines were maintained in RPMI-1640 with 10% fetal bovine serum. Cell lines were validated, as previously described(18 (link),43 (link),44 (link)), and tested for mycoplasma every 6 months by Universal Mycoplasma Detection Kit (ATCC). T8ML1 cell lines were generated from a PTCL, NOS patient(45 (link)), and maintained with supplemented IL-2 RPM1 media. Stable expression of doxycycline-inducible shRNA was generated with lentiviral mediated transduction of plko-Tet-On vectors. Oligo sequences for CSF1R shRNA#1: CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG, shRNA#2: CCGGGAATCTCACAGGACCTCTTAGCTCGAGCTAAGAGGTCCTGTGAGATTCTTTTTTG and scramble: CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTT. Knock-down of CBFA2T3 was performed with sigma mission pLKO.1 shRNA vectors, TRCN0000020164 (shRNA #1) and TRCN0000020165 (shRNA #2).
Protocol detail
Validation of Cell Line Models for Hematological Cancers
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Alcl
Cbfa2t3
Cell
Cell lines
Csf1r
Ctcl
Doxycycline
Fetal bovine serum
Knock
Mac 1
Mycoplasma
Oligo
Patient
Shrna
Vectors
Corresponding Organization : University of Michigan–Ann Arbor
Other organizations : University of Pennsylvania, University of Pittsburgh, Henry Ford Hospital
Top 5 similar protocols
Variable analysis
independent variables
- Doxycycline-inducible shRNA for CSF1R knockdown
- ShRNA for CBFA2T3 knockdown
- Cell growth and viability of the following cell lines: SR786, Karpas290, SUP-M2, SUDH1L, DEL, MyLa, Mac-1, T8ML1
- Cell culture conditions: RPMI-1640 with 10% fetal bovine serum
- Cell line validation and mycoplasma testing
- Positive control: Scramble shRNA
- Negative control: Untreated cell lines
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!