Quantitative RT-PCR Analysis of Gene Expression

1 x 10⁸ cells were harvested at 800 g for 10 minutes at 4˚C and washed
in ice-cold PBS and quick-frozen in dry ice for 1 minute. RNA was purified using
an RNeasy minikit (Qiagen) according to the manufacturer’s instructions. The RNA
concentration was quantified using an ND-1000 spectrophotometer (Nanodrop
Technologies). qRT-PCR was performed using iQ-SYBR green Supermix on a
MiniOpticon real-time PCR (RT-PCR) detection system (Bio-Rad), and quantified
using OPTICON3 software (Bio-Rad) 52 (link). The
following primers were used: IGP48-RTF (CTGCAGGCTGCCAGCTCTG), IGP48-RTR
(TTTAATCTCCCGTACGCAGG), IGP40-RTF (CTGCATGTGACTGCTGCT), IGP40-RTR
(TGAAAGGGTATACAACTGACC), IGP34-RTF (ATTGCGTCTACCGATGGAAC), IGP34-RTR
(TAGACTCCTCATCTGAATGC). Data were normalised against TERT (telomerase reverse
transcriptase) (TERT-RTF (GAGCGTGTGACTTCCGAAGG) and TERT-RTR
(AGGAACTGTCACGGAGTTTGC).

Free full text: Click here

Allison H., O’Reilly A.J., Sternberg J, & Field M.C. (2014). An extensive endoplasmic reticulum-localised glycoprotein family in trypanosomatids. Microbial Cell, 1(10), 325-345.

Publication 2014

RNeasy minikit ND-1000 spectrophotometer iQ-SYBR green Supermix OPTICON3 software

Cells Cold Dry ice Frozen G 800 Primers Sybr green Telomerase Tert

Corresponding Organization :

Other organizations : University of Dundee, University of Aberdeen

Top 5 similar protocols

Variable analysis

independent variables

Harvesting cells at 800 g for 10 minutes at 4°C

dependent variables

RNA concentration quantified using an ND-1000 spectrophotometer
Gene expression quantified using qRT-PCR and OPTICON3 software

control variables

Washing cells in ice-cold PBS
Quick-freezing cells in dry ice for 1 minute
Using RNeasy minikit (Qiagen) for RNA purification
Using iQ-SYBR green Supermix and MiniOpticon real-time PCR (RT-PCR) detection system (Bio-Rad) for qRT-PCR
Normalizing data against TERT (telomerase reverse transcriptase)

controls

No positive or negative controls were explicitly mentioned in the provided information.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!