Spatiotemporal Modulation of Etsrp Signaling

The antisense morpholinos (MO) for etsrp were purchased from GeneTools and prepared as 1mM stock solutions using ddH₂O. The sequence of etsrp MO is: 5' - TTGGTACATTTCCATATCTTAAAGT - 3', described as previously reported^{55 (link)}. Capped fish fev full-length mRNA for injection was synthesized from NotI-digested pCS2+ expression plasmid using the mMessage mMachine SP6 kit (mMessage mMachine SP6 kit; Ambion, AM1340). For fish embryo injections, etsrp MO (0.4mM) with capped fev mRNA (100pg) were injected alone or in combination, into 1-2 cell-stage zebrafish wildtype embryos at the yolk/blastomere boundary. For temporal-controlled overexpression of fev, the fev full-length cDNA was cloned into a pDNOR221 vector by BP reaction (Gateway BP Clonase II Enzyme mix; Invitrogen, 11789020) and then subcloned into pDestTol2pA2 with hsp70 promoter and EGFP reporter by LR reaction (LR Clonase II Plus enzyme; Invitrogen, 12538200) by Gateway systems. After injection of hsp70-fev-eGFP together with tol2 mRNA to wildtype and etsrp^y11, the embryos were heat-shocked at 37°C for 1 hour at 3s.