ChIP-qPCR Analysis of ZEB1 Binding

ChIP was performed as previously described [29 (link)]. Briefly, cells were fixed for 15-minutes in RMPI-1640 media containing 10% FBS and 1% Formaldehyde, and fixation quenched through addition of Glycine (final concentration 0.125M). Fixed cells were lysed and chromatin sheared to a size of 100–500 bp. ChIP was performed using 5µg of an anti-ZEB1 antibody (Santa Cruz, Cat# sc-25388X). As a negative control, normal rabbit IgG (Cell Signaling Technology, Cat# 2729S) was used. Input samples were generated by taking the supernatant of the normal rabbit IgG immunoprecipitation. Input and ChIP samples were subjected to qPCR in sextuplet using primers against an E-box near the transcriptional start site of BCL2L11 (Forward: cgggaggctagggtaca, Reverse: caggctcggacaggtaaag), or against an E-box near the 5’-end of Exon 2 of BCL2L11 (Forward: ctaaccccgggaagtcagag, Reverse: agggtacccccaaacaaaat).

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Song K.A., Niederst M.J., Lochmann T.L., Hata A.N., Kitai H., Ham J., Floros K.V., Hicks M.A., Hu H., Mulvey H.E., Drier Y., Heisey D.A., Hughes M.T., Patel N.U., Lockerman E.L., Garcia A., Gillepsie S., Archibald H.L., Gomez-Caraballo M., Nulton T.J., Windle B.E., Piotrowska Z., Sahingur S.E., Taylor S.M., Dozmorov M., Sequist L.V., Bernstein B., Ebi H., Engelman J.A, & Faber A.C. (2017). Epithelial-to-mesenchymal transition antagonizes response to targeted therapies in lung cancer by suppressing BIM. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 197-208.

Publication 2017

anti-ZEB1 antibody normal rabbit IgG

Anti antibody Bp 100 Cells Chip Chromatin Exon Formaldehyde Glycine Immunoprecipitation Primers Rabbit Sextuplet Transcriptional start site

Corresponding Organization : Harvard University

Other organizations : Kanazawa University, Virginia Commonwealth University

Top 5 similar protocols

Variable analysis

independent variables

ChIP was performed using 5µg of an anti-ZEB1 antibody

dependent variables

Enrichment of E-box regions near the transcriptional start site and exon 2 of BCL2L11 gene as measured by qPCR

control variables

Cell type
Fixation conditions (15-minutes in RMPI-1640 media containing 10% FBS and 1% Formaldehyde)
Chromatin shearing size (100–500 bp)

controls

Positive control: Normal rabbit IgG (Cell Signaling Technology, Cat# 2729S)
Negative control: Input samples generated from the normal rabbit IgG immunoprecipitation

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!