Embryos were moved from pregnant females that had been anesthetized with CO2 and placed on ice. The dorsal cerebral cortices (E14.5-PND10) were dissected, or the total telencephalon was removed (E10.5-E12.5). The tissue was immediately transferred to Trizol reagent (Invitrogen, Camarillo, CA) and processed for total RNA isolation according to the manufacturer’s protocol. Then, the total RNA was reverse-transcribed into cDNAs using a Prime Script RT reagent kit (Takara, Japan) for quantitative PCR (ABI Step One Plus, Foster City, CA) in the presence of a fluorescent dye (SYBR Green I; Takara). The relative expression of genes was determined using the 2-ΔΔct method with normalization to GAPDH expression. The primers for RT-PCR were designed based on published mouse gene sequences. The primers for Nsun5, Cdc42, RhoA, PKC, Akt and GAPDH are listed in Table 1 [29 (link), 31 (link), 55 (link)].

Primers for quantitative real-time PCR

ForwardReverse
Nsun5GAGGGAAGGGTGGATAAGGGGCACGATGCGGATGTAG
Cdc42GTTGGTGATGGTGCTGTTGCTGTGGATAACTTAGCGGTCG
RhoACATTGACAGCCCTGATAGTTTCGTCATTCCGAAGGTCCTT
PKCACCCTCGTAGAGAAGCGTGTTGAAAGTGGAGTGAAGCTG
GAPDHTGGGTGTGAACCACGAGACCACAGTCCATGCCATCAC
Free full text: Click here