Bdellovibrio predation on E. coli: Gene expression

Synchronous predatory infections of Bdellovibrio bacteriovorus HD100 on E. coli S17-1 as well as S17-1 alone were set up as previously described30 (link) with samples throughout the timecourse being taken and total RNA isolated from them. RNA was isolated from the samples using a Promega SV total RNA isolation kit with the RNA quality being verified by an Agilent Bioanalyser using the RNA Nano kit. RT-PCR was performed with the Qiagen One-step RT-PCR kit with the following reaction conditions: One cycle 50 °C for 30 mins, 95 °C for 15 mins, then 25 cycles of 94 °C for 1 min, 48 °C for 1 min, 72 °C for 2 mins, and finally a 10 mins extension at 72 °C after the 30 cycles, and finally a 4 °C hold. All experiments were carried out with at least 2 biological repeats. Primers to anneal to bd0468 were (5′-3′): Bd0468 RT-F CAAAGGTAACGAAGCGATCC and Bd0468 RT-R AGTTCGTGGAAGTTCGGATG Primers to anneal to bd3279 were (5′-3′): Bd3279 RT-F ACGCGTGCTTGGGAACCAGC and Bd3279 RT-R ACTTCCGCAGCCGCTTCATCG.