Establishing Galectin-3 Knockout in A2780 Cells

HOMECs (ScienCell Research Laboratories) were cultured in endothelial cell medium (ECM; catalog no. 1001), and ovarian carcinoma A2780 cells (Sigma-Aldrich, catalog no. 93112519) were cultured in RPMI 1640 medium. Each was supplemented with penicillin (100 U ml⁻¹) and streptomycin (100 μg ml⁻¹). Tumor KO-g3 A2780 cells were developed using CRISPR-Cas9 methods and selected on puromycin (1 mM). Single guide RNAs (gRNAs) targeting the exon 3 of galectin-3 were designed for the KO study. The designed guides were screened in silico for off-target activity using the CRISPR search with mismatches, insetions and/or deletions (COSMID) webtool (53 (link)), and the gRNA (CATGATGCGTTATCTGGGTC) with the least number of off targets was selected for the KO experiments. The guide was delivered as a ribonucleoprotein complex with Cas9 to the A2780 cell line using an optimized nucleofection protocol.