AVs expressing the Flag-TSC22D4 alleles (WT, ∆D2, and D2 + TSC) under the control of the cytomegalovirus promoter were cloned using the BLOCK-iT adenoviral expression system (Invitrogen). Viruses were purified by the cesium chloride method and dialyzed against phosphate-buffered saline buffer (PBS) containing 10% glycerol before animal injection, as described (34 (link)).
For generating AAVs with cDNAs of TSC22D4, alleles (WT, ∆D2, and D2 + TSC) were amplified with the following primer pairs followed by Nhe 1 and Xba 1 digestion and subcloning into pdsAAV-LP1 plasmid (35 (link)): TSC22D4-AAV with Nhe I: forward, gatgctagcgtgtgctggaattctg; TSC22D4-AAV with Xba I: reverse, gcatctagactcgagtcagatggaggg. The successful clones sequenced for confirmation with the following primers: pdsAAV-TSC: forward, ctgataggcacctattggtc; reverse, ccacaactagaatgcagtg. Once the sequence is confirmed, the plasmids were purified using QIAGEN Megaprep kit (#12381) according to the manufacturer’s instructions and sent to Vigene Biosciences (Maryland, USA) for AAV generation, purification, and titration.
For generating AAVs with cDNAs of TSC22D4, alleles (WT, ∆D2, and D2 + TSC) were amplified with the following primer pairs followed by Nhe 1 and Xba 1 digestion and subcloning into pdsAAV-LP1 plasmid (35 (link)): TSC22D4-AAV with Nhe I: forward, gatgctagcgtgtgctggaattctg; TSC22D4-AAV with Xba I: reverse, gcatctagactcgagtcagatggaggg. The successful clones sequenced for confirmation with the following primers: pdsAAV-TSC: forward, ctgataggcacctattggtc; reverse, ccacaactagaatgcagtg. Once the sequence is confirmed, the plasmids were purified using QIAGEN Megaprep kit (#12381) according to the manufacturer’s instructions and sent to Vigene Biosciences (Maryland, USA) for AAV generation, purification, and titration.
