Quantifying Mitochondrial and Antioxidant Gene Expression

Total RNA was isolated by a single step of guanidinium isothiocyanate/phenol extraction using PureZol RNA isolation reagent (Bio-Rad Laboratories, Segrate, Italy) (Brivio et al., 2021 (link)). Real-time polymerase chain reaction (RT-PCR) was performed to assess Cytochrome c oxidase 1 (Cox1) (Rn03296721_s1), Cox3 (Rn03296820_s1), Catalase (Cat) (Rn00560930_m1), and Glutathione peroxidase 1 (Gpx1) (Rn00577994_g1, Thermo Fisher Scientific, Monza, Italy) mRNA levels. RNA was analyzed by TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad Laboratories, Segrate, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories, Italy). Samples were run in 384 well formats in triplicate as multiplexed reactions with the normalizing internal control 36B4 (primer fw TCAGTGCCTCACTCCATCAT, primer rev AGGAAGGCCTTGACCTTTTC, probe TGGATACAAAAGGGTCCTGG, Eurofins genomics, Vimodrone, Italy). A comparative cycle threshold (Ct) method was used to calculate the relative target gene expression.

Free full text: Click here

Brivio P., Gallo M.T., Karel P., Cogi G., Fumagalli F., Homberg J.R, & Calabrese F. (2022). Alterations of mitochondrial dynamics in serotonin transporter knockout rats: A possible role in the fear extinction recall mechanisms. Frontiers in Behavioral Neuroscience, 16, 957702.

Publication 2022

PureZol RNA isolation reagent TaqMan qRT-PCR instrument (CFX384 real-time system, iScriptTM one-step RT-PCR kit for probes

Catalase Cytochrome c oxidase Gene expression Glutathione peroxidase 1 Guanidinium Isolation Isothiocyanate Mrna Phenol Primer Real time polymerase chain reaction Rt pcr

Corresponding Organization :

Other organizations : University of Milan, Radboud University Nijmegen, Radboud University Medical Center

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

MRNA levels of Cytochrome c oxidase 1 (Cox1)
MRNA levels of Cytochrome c oxidase 3 (Cox3)
MRNA levels of Catalase (Cat)
MRNA levels of Glutathione peroxidase 1 (Gpx1)

control variables

36B4 (internal control)

controls

Positive control: None mentioned
Negative control: None mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!