Generation of Recombinant TCR Expression Plasmids

To generate a TCR α and β co-expression plasmid, the C-region of TCRα and β chain were first amplified from cDNA from wild type splenocytes and ligated into the pMX-IP vector (Cell Biolabs). Pd-reactive T cells were collected, RNA extracted using the RNeasy mini kit (QIAGEN), and then cDNA synthesized using Superscript III (ThermoFisher Scientific). The cDNA was then used to generate TCRα and β libraries as described previously (21 (link)). Each TCR library was mixed with a forward primer consisting of the annealing site of the adapter DNA (5’- AGCTAGTTAATTAAGGATCCTGATCACCGGACAGGAATTCC -3’) and 20 bps overlapping the pMX-IP vector and a reverse primer specific for the C-region of the TCR α and β (for TCRα 5’- TGGTACACAGCAGGTTCTGGGTTC-3’, for TCRβ 5’- CAAGGAGACCTTGGGTGGAGTCAC-3’). Next, TCR fragments were amplified by PCR. PCR fragments were ligated into the pMX-IP vector digested with BamHI and XhoI (TakaraBio) by mix with NEBuilder HiFi DNA Assembly Master Mix (New England Bio. Lab.) and incubation at 50°C for 15 min. The resulting vectors were transformed into NEB5α competent cells. Transformed cells were spread on LB agar plates and incubated for 16 hours at 37°C. Colonies were then collected, and mixed plasmids were purified using a QIAGEN miniprep kit.