Quantitative RT-PCR analysis of immune genes

Quantitative real-time PCR assay was performed as previously described33 (link). Total RNA was harvested from cells using an RNeasy kit (Qiagen) and subjected to DNase I digestion (New England BioLabs). Quantitative real-time PCR was performed using an Applied Biosystems ABI Prism 7900HT instrument with ABI Fast SYBR green Master Mix (Applied Biosystems), and data were normalized to endogenous control 18 S rRNA. Relative expression or fold induction was calculated using 2^−ΔΔCt method with the normalized Ct value of the untreated or mock treated sample at the earliest time point being the baseline. Primers for mouse genes were chosen according to the recommendation of the qPrimerDepot database39 (link). Primer sequences were as follows: mouse IFN-β, AATTTCTCCAGCACTGGGTG and AGTTGAGGACATCTCCCACG; mouse RANTES, CTGCTGCTTTGCCTACCTCT and CACTTCTTCTCTGGGTTGGC; mouse IL-6,; 18 s rRNA, CCTGCGGCTTAATTTGACTC and AACCAGACAAATCGCTCCAC; HSV-1 ICP27, CCTTTCTCCAGTGCTACCTG and GCCAGAATGACAAACACGAAG; HSV-1 UL23, AGAAAATGCCCACGCTACTG and CACCTGCCAGTAAGTCATCG; HSV-1 UL44, CGACTACAGCGAGTACATCTG and CGATTCCAATCCCCACCC.