ASOs 1, 3 and 4 (sequence 5′-GCTCATACTCGTAGGCCA-3′, position 791–808) and 2 (sequence 5′-CTCATACTCGTAGGCC-3′, position 792–807) are complementary to Mus musculus TNFRSF1A-associated via death domain (TRADD) mRNA (Genbank accession no. NM_001033161). The ASO lead 1a is the murine homolog (a G to A base change at position 5) of the human TRADD lead reported previously (28 (link)). Control oligonucleotides 5 (5′-GCCCAATCTCGTTAGCGA-3′) were designed with six mismatches to 4, such that they contained ≥4 mismatches to all known mouse sequence. ASOs 6 and 7 (sequence TCTGGTACATGGAAGTCTGG, position 8232–8251) and 8 (sequence AAGTTGCCACCCACATTCAG, position 5586–5605) are complementary to Mus musculus apolipoprotein B (ApoB) mRNA (Genbank accession no. XM_137955.5). The sequences were identified by a screen of 5-10-5 MOE 20mer ASOs as described previously (29 (link)–31 (link)). ASOs 9, 10 and 11 (sequence 5′-CTGCTAGCCTCTGGATTTGA-3′, position 1931–1950) are complementary to M.musculus phosphatase and tensin homolog (PTEN), mRNA (Genbank accession no. NM_008960). ASO 9 (18 (link)) and control oligonucleotide 12 (19 (link)) have been described previously.
MOE phosphoramidites were prepared as described previously (7 ,32 ,33 (link)). LNA and 2′-deoxyribonucleoside phosphoramidites were purchased from commercial suppliers. Oligonucleotides were prepared similar to that described previously (34 (link)) on either an Amersham AKTA 10 or AKTA 100 oligonucleotide synthesizer. Modifications from the reported procedure include: a decrease in the detritylation time to ∼1 min, as this step was closely monitored by UV analysis for complete release of the trityl group; phosphoramidite concentration was 0.1 M; 4,5-dicyanoimidazole catalyst was used at 0.7 M in the coupling step; 3-picoline was used instead of pyridine for the sulfurization step, and the time decreased from 3 to 2 min. The oligonucleotides were then purified by ion-exchange chromatography on an AKTA Explorer and desalted by reverse phase HPLC to yield modified oligonucleotides in 30–40% isolated yield, based on the loading of the 3′-base onto the solid support. Oligonucleotides were characterized by ion-pair-HPLC-MS analysis (IP-HPLC-MS) with an Agilent 1100 MSD system. The purity of the oligonucleotides was ≥90% (Supplementary Table S1).