The samples of the ‘Huntington Disease’ and the ‘serial dilution’ data series were amplified in 96-well plates in an Applied BioSystems ABI7300. The qPCR reaction was done in 20 µl with primers for ATG5 (Forward: GGCCATCAATCGGAAACTCAT; Reverse: AGCCACAGGACGAAACAGCTT; product: 123bp), PSMB5 (Forward TGTCCCAGAAGAGCCAGGAAT; Reverse: GCAATGTAAGCACCCGCTGTA; product 116 bp) or EEF1A1 (Forward: AAGCTGGAAGATGGCCCTAAA; Reverse: AAGCGACCCAAAGGTGGAT; product: 54 bp), Q-PCR SYBR Green Mastermix (Applied Biosystems) in a concentration of 0.3 µM. The used protocol was identical for all primer sets: 10 min 95°C, 40× (15 s 95°C, 30 s 60°C, 30 s 72°C).
The samples of the ‘developing chicken heart’ dataset were amplified in 384-well plates in a Roche LightCycler480. The qPCR reaction was done in 10 µl with a primer concentration of 1 µM and SYBR Green qPCR Master Mix (Roche). The primers used were NppB (Forward: GATGCCCAGGATGATGAGAG; Reverse: CCTTGGGAGGATCAGGTTCT; product 157 bp), NDUFB3 (Forward: CTCGAGGAGGTCCAAAGAAGGT; Reverse: GTGGCAGGTTTTGCATAGCC; product 101 bp). These samples were measured in three separated runs using the following protocol 5 min 96°C, 45× (10 s 95°C, 20 s 58°C, 20 s 72°C).
The samples of the ‘developing chicken heart’ dataset were amplified in 384-well plates in a Roche LightCycler480. The qPCR reaction was done in 10 µl with a primer concentration of 1 µM and SYBR Green qPCR Master Mix (Roche). The primers used were NppB (Forward: GATGCCCAGGATGATGAGAG; Reverse: CCTTGGGAGGATCAGGTTCT; product 157 bp), NDUFB3 (Forward: CTCGAGGAGGTCCAAAGAAGGT; Reverse: GTGGCAGGTTTTGCATAGCC; product 101 bp). These samples were measured in three separated runs using the following protocol 5 min 96°C, 45× (10 s 95°C, 20 s 58°C, 20 s 72°C).
